... Carbamide . ... Moscowљ? ... URALCHEM and Stamicarbon will develop a new technology for urea production . URALCHEM, a leading Russian producer of nitrogen fertilizers, signed a joint technology development agreement for the synthesis of urea with Stamicarbon, the world's top developer and licensor of urea processes. ... Laboratory of Chemical Thermodynamics љwasљestablished by Prof. Adam V. Rakovsky (corresponding member of USSR Academy of Sciences) first as a "halurgy laboratory" in 1930. ...

Еще в разделе: (Показать все результаты (>92) - td.chem.msu.ru/ )

• Research Areas Laboratory of Chemical Thermodynamics
• PhDi Laboratory of Chemical Thermodynamics
• Colloquium on 21.02.08 Laboratory of Chemical Thermodynamics

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>60) - nanofluidics.phys.msu.ru/ )

... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...

Еще в разделе: (Показать все результаты (>189) - www.mgubs.ru/ )

• Конкурс на лучшее эссе года
• Высшая школа бизнеса МГУ им. Ломоносова

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>88) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/prokhorov/index.htm

. Faculty of Mechanics and Mathematics, . M.V. Lomonosov Moscow State University . This site is created and supported by . the A.M. Liapunov French-Russian Institute . of Moscow State University .

Еще в разделе: (Показать все результаты (>116) - new.math.msu.su/ )

MOSCOW STATE UNIVERSITY -- Faculty of Biology -- Department of Human Physiology -- . ... Our interest is the secret springs of work of a brain. How can a new idea be born in the brain if the physical environment remains constant? ... What mechanisms of the brain are broken in schizophrenia? ... For this purpose we create brain-computer interfaces (BCI) based on modern methods of computational electroencephalography. ... Department of Human Physiology . ... Former Visitors . ... Former students . ...

Еще в разделе: (Показать все результаты (>101) - brain.bio.msu.ru/ )

• EEG Database - Schizophrenia
• Лаборатория нейрофизиологии и нейро-компьютерных интерфейсов (бывш. Группа

... Регистрация . ... Форумы > Аспирантура > Регистрация . ... Please, enter the code that you see below in the input field. This is for blocking bots that try to post this form automatically. If the code is hard to read, then just try to guess it right. If you enter the wrong code, a new image is created and you get another chance to enter it right. ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>6534) - www.mmonline.ru/ )

• MMOnline | Форумы | Разное
• MMOnline | Форумы | Первокурсникам
• MMOnline | Форумы | Кафедры

... Инновационная . структура МГУ . ... деятельности . ... Process of Forming a Company . ... Finance for Start-Up . ... In the commercial world, the business manager (entrepreneur, Chief Executive Officer (CEO), Chief Operating Officer (COO):) must create the infrastructure and face many issues specific to the establishment and development of a new company. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>44) - innovation.msu.ru/ )

Backlinks to EditingShorthand in all Webs ( Search System Web only ) . ... Foswiki Release 1.0.10 08 Sep 2010 Foswiki The Free and Open Source Wiki Foswiki is an enterprise collaboration and information sharing tool targeted for professional .. NEW - 12 Sep 2010 - 22:13 by ProjectContributor . ... Topics #SystemWebFigure Figure: depiction of WebHome, ReferenceManual, ManagingTopics, ManagingWebs, MainFeatures topics contained in the System web #TopicDefinition .. ... Number of topics: 4 . ...

Еще в разделе: (Показать все результаты (>13367) - wiki.cs.msu.ru/ )

• GenPDFExampleTitleTopic < Sandbox < Foswiki
• (backlinks in System Web) EditingShorthand < System < Foswiki
• (backlinks in System Web) VarPUBURL < System < Foswiki

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>45) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf

... Sections . ... Atlas "Birds of Moscow City" . ... Breeding bird atlas of European Russia . ... Annual report, issue 1 . ... The Fauna and Abundance of European Russia Birds", issue 1 . ... Br eeding bird atlas of European Russia . ... Project outputs : Accurate mapping of Russian birds in the 2nd European Breeding Bird Atlas, and a groundbreaking Atlas of Breeding Birds of European Russia . ... Atlas "Birds of Moscow City" Monitoring of common birds Breeding bird atlas of European Russia . ...

Еще в разделе: (Показать все результаты (>5436) - zmmu.msu.ru/ )

• Collection of books
• Exhibition
• Mammalogy

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>20) - mouse.genebee.msu.ru/ )

... Opening of the educational programme - School of CEOs, "Capsule of security" for the key managers of Bashneft Group. 2013/04/02 - 4:30pm . ... Shmeleva Elena Vladimirovna . ... Research interests - strategic and corporate governance, culture of innovation, HSE-management, talent management, corporate social responsibility, quality management system of higher education. ... The head of more than 200 research projects. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• School overview | MSU Higher school of management and innovation
• Message from Victor Antonovich Sadovnichy - Rector of Lomonosov Moscow State
• Deanery | MSU Higher school of management and innovation

... As a perfect bag of Hermes, it isn?t strange to determine it sold at $6,750. ... Didn`t suggest we don?t adore determine producer creative designers, . ... We will try our excellent to dig his worth come up with him merged properly making use of the brand, . ... I stated to plenty of folks that Christophe may be among the many most ideal one, . ... Leather: Handbags created by Hermes uses only animal skin. ... http://www.slcamera.it/every-man-adores-his-car/ . ...

Еще в разделе: (Показать все результаты (>71) - elana.sinp.msu.ru/ )

• ralph lauren outlet uk Health Benefits of Soft Water | С Днем Победы!
• cheap moncler uk Adaptive Shirts for Decreased Shoulder Range of Motion | С
• absurdly. | С Днем Победы!

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>2232) - swx.sinp.msu.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features . ... X-COM: Distributed Computing Software . SIGMA: Collective Bank of Tests on Parallel Computing . ... Every teacher can make up his own set of tests using the collective data bank or using his own questions. ... Universities participating: 20 . ... Tests held: 413 . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...
• Supercomputing Education Project | Moscow University Supercomputing Center
• Nationwide Supercomputing Education Project | Moscow University Supercomputing

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>31) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

Вход в личный кабинет . ... Ярмарка вакансий и стажировок для студентов и выпускников вузов . Новости науки и техники События . ... Подписаться на новости . Вакансии . ... Компания: Nielsen company . The Nielsen Company is a market-leading information & media company with more than 41,000 employees in 100+ countries around the world. ... Please send your CV before June 9th marked in Subject line Summer Internship Program at: RussiaMoscow.HR@nielsen.com or info.russia@nielsen.com . ...

Еще в разделе: (Показать все результаты (>162) - www.physcareer.ru/ )

• ЗАО КБ 'Ситибанк' ПРИГЛАШАЕТ НА РАБОТУ / Вакансии / Physcareer.ru

The Laboratory of the Historical Information Science . ... The historical information science laboratory was founded within the structure of the source studies department on 8 December 1995 for the purpose of fulfilling the decision of the academic council of the History Faculty of 4 October 1991 about the transformation of a group for the application of mathematic methods and mainframes in historical research in the laboratory of historical information sciences. ... Senior laboratory assistant (2) . ...

Еще в разделе: (Показать все результаты (>4349) - www.hist.msu.ru/ )

• ЭОС истфака МГУ: Кафедра исторической информатики
• ЭОС истфака МГУ: Course categories
• Электронная образовательная среда исторического факультета МГУ имени