. [ Войти ] . Главная -> Пользователи -> gz:researcher . Пользователи . Демо . Деньги . Фильмы . Форум . gz:researcher . Появление: 24.05.2010 14:23:30 . Последнее созидание: 31.12.2009 . Сообщений: 72 . Рейтинг: . 0 0 0 0 .

Еще в разделе: (Показать все результаты (>201) - kinfo.ru/ )

• Soul Searcher - Фильмы - Kinfo.ru
• Searchers 2.0 - Фильмы - Kinfo.ru
• The Searchers - Фильмы - Kinfo.ru

Школа танцев Грация-МГУ . ... Грация-МГУ::Форум Общение Общение . Current хочу: . ... Weasel . Sep 3 2007, 13:16 . Сообщение #1 . ... Впереди еще пол-пути, . ... Предыдущая тема Общение Следующая тема . ... Танцевальная жизнь Общение |- Общение |- ... Подписка на тему Сообщить другу Версия для печати Подписка на этот форум . ...

Еще в разделе: (Показать все результаты (>938) - grace.msu.ru/ )

• Грация-МГУ::Форум > Current хочу:
• Технические работы на сервере - Грация-МГУ::Форум

Конкурс на лучшее эссе года . 29 мая в ВШБ МГУ состоялась торжественная церемония награждения победителей конкурса "Лучшее эссе года". Были выбраны победители в 10 номинациях. Победителями конкурса стали: . Башмет Александр - номинация Model Essay . Рассохина Александра - Artful Essay . Скотникова Яна - Creative Essay . ... Шубин А., Макаренко А. - Easy Writers . Титаренко Н., Дюльгерова Н., Камнева К., Ещенко О. - победители в группах. ...

Еще в разделе: (Показать все результаты (>153) - www.mgubs.ru/ )

Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . You may download the latest source code distribution and install the period search service at your own web server. ...

Еще в разделе: (Показать все результаты (>3) - scan.sai.msu.ru/ )

. Search Engines . about laboratory | staff | administration | research | education | news | search | links | text only . Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. If you have any questions or cannot find the information you need, mail to webmaster . Last updated 20 April 2001 .

Еще в разделе: (Показать все результаты (>91) - www.kge.msu.ru/ )

• Search Catalogues
• Search in Internet
• Laboratory of Catalysis and Gas Electrochemistry

Online Services | ... Research) IPN(Institute Physics Nuclear, Paris) ISN(Institute Science Nuclear, Grenoble) JINR(Joint Institute Nuclear Research) JUL-Spez(Institute fur Kernphysik) JYFL(University Jyvaskyla, Finland) LA(Los Alamos Science Laboratory) LBL(Lawrence Berkeley Laboratory) NEANDC(Nuclear Data Committee) ORNL(Oak Ridge National Laboratory) UTTAC(University Tsukuba Center) ZFK(Zentralinstitut fur Kernforschung) **************************************************** Other Code . ... Code: . ...

Еще в разделе: (Показать все результаты (>44) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => Nucleus Ground State Parameters
• EXFOR Search Engine

... News . ... The major part of the course is dedicated to the studying measuring devices and units for data collection and processing, re-engineering of unknown circuits. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ... Working on a course project: testing of a board or a device with unknown malfunctioning, faultfinding and debugging, demonstration of the functioning device. ... 2013-2015 Engineering Physics Laboratory...

Еще в разделе: (Показать все результаты (>101) - engineering.phys.msu.ru/ )

• Introduction to Linux
• Serguey Zapunidi
• Anatoliy Sizov

Russian . Next: Features searching Up: Data Analysis (Operations Menu) Previous: Reconstruction of 3D Images Contents Index . User can make surface section over curve. To do this you should create a desired curve using curve drawing regime (see ), and execute the command Convert Curve to Section . Desired section will be drawn in a new window. Russian . Next: Features searching Up: Data Analysis (Operations Menu) Previous: Reconstruction of 3D Images Contents Index Filonov 2005-02-04

Еще в разделе: (Показать все результаты (>143) - www.spm.genebee.msu.ru/ )

• Sensor with Remote Operation for Chemical and Biological Protection
• Shramko Jane
• Features searching

... Class . ... public class NetcdfFile . ... A concrete implementation of the Netcdf interface, this class provides connection to NetCDF version 1 files. ... NetcdfFile (java.io.File file, boolean clobber, boolean fill, Schema template) . ... Constructor Detail public NetcdfFile (java.io.File file, boolean clobber, boolean fill, Schema template) throws java.io.IOException . ... public NetcdfFile (java.lang.String path, boolean clobber, boolean fill, Schema template) throws java.io.IOException . ...

Еще в разделе: (Показать все результаты (>75) - angel.cs.msu.su/ )

• : Class IndexIterator
• : Class ConcreteIndexMap
• : Class AbstractNetcdf

This document explains how to install, configure and run Apache 1.3 under Novell NetWare 5.x and above. ... Apache 1.3 is designed to run on NetWare 5.x and above and is installed by default on all NetWare 6 servers. ... You will need to compile apache and copy the files over to the server manually. ... Follow these steps to install Apache on NetWare from the binary download (assuming you will install to sys:/apache): . ... Copy the MIME.TYPES and magic files to SYS:/APACHE/CONF directory . ...

Еще в разделе: (Показать все результаты (>87) - neptun.sai.msu.ru/ )

• Manual Page: dbmmanage - Apache HTTP Server
• Manual Page: httpd - Apache HTTP Server
• Anatoly V. Zasov

... Department of Chemistry, Lomonosov Moscow State University, 1974 . Academic degree . ... D. (Organic Chemistry), 1985 . ... Department of Chemistry, Lomonosov Moscow State University, Leninskie gory 1/3, Moscow 119991 Russia . ... organic chemistry, medicinal chemistry, chemoinformatics, QSAR, organic synthesis, conformation analysis, computer-aided drug design, molecular modeling, receptors, docking, virtual screening, mathematical chemistry . ... v.a.palyulin . ... Palyulin, Vladimir A. Home . ...

Еще в разделе: (Показать все результаты (>33) - qsar.chem.msu.ru/ )

• Voronkov, Andrew E. - Laboratory of Medicinal Chemistry
• Karpov, Pavel V. - Laboratory of Medicinal Chemistry
• Dmitry Osolodkin - Laboratory of Medicinal Chemistry

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Keldysh Institute of Applied Mathematics of RAS . DRIVER: 3D numerical modelling of high energy density plasma physics . ... AREA: Plasma Physics . ... IMPACT: The expected results of numerical experiments will help to explain the observed statistical characteristics of molecular hydrogen clouds in external galaxies. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• APPLICATIONS: Fundamental Medicine and Phisiology | Moscow University
• APPLICATIONS: Organic Chemistry | Moscow University Supercomputing Center
• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...

Title Author Key words Transformation of Russian society stratification in Post-Soviet period Sachuk D.I. transformation of a stratification, stratification, social structure, classes, middle class, creative class The article focuses attention on basic stages of transformation of a stratification of the modern Russian society. ... Also in article the author takes an attempt to note the main trends of transformation of a stratification of the Russian society during the Post-Soviet period. ...

Еще в разделе: (Показать все результаты (>80) - www.socio.msu.ru/ )

• Вестник МГУ

Web-site http://polly.phys.msu.su/seminar/vms/ 22.01.02 15.00 - , 2002 ( 2002) 47(653), 23 2001. ... 2002 , ( 5 ) .( ... WWW- http://intra.rfbr.ru/ "e-polymers" "e-polymers" Advantages of the new internet journal "e-polymers" 1. ... New Journal of Physics (NJP) is a peer-reviewed, all electronic journal. ... Journal web site (www.njp.org) (, .) (). 8 7 2002 ( - 28 2001 .). , , : · · · · , , , , . ... The first announcement is now available on the web site: http://www.ccr.jussieu.fr/ecis2002/ . ...

Еще в разделе: (Показать все результаты (>481) - polly.phys.msu.ru/ )

• CV of Tatiana Burova
• Scientific Interests
• Palyulin Research Page

... Data and place of birth: . ... Excitation of nuclear and hadron degree of freedom in hadron-nucleus interaction . ... Participation in experiments: . The theoretical calculation and the analysis of data in experiment of ITEP (Moscow,1972-1978) on the Rho-meson production by pions at 3.72 Gev/c on nuclear target . ... The analysis of data in SMS MSU experiment (Dubna, 1985-1990) devoted to the space-time structure of hadron interaction in proton- nucleus collisions at 9 GeV/c (JINR accelerator) . ...

Еще в разделе: (Показать все результаты (>74) - lav01.sinp.msu.ru/ )

• Involving Hadronic Interactions Laboratory in Experiments
• Title and CV of Olga Kodolova
• History of Strong Interactions Laboratory

Basic research of intelligence: a way to creation of advanced computer technologies . ... The problem of creation of a fundamental approach to studies on intelligence in the framework of psychologic content and demands in the development of computer (intellectual) technologies is put forward. PostScript (in Russian) (118KB) . PDF (in Russian) (105KB) . PostScript.zip (in Russian) (33KB) . PDF.zip (in Russian) (43.9KB) . Ryabov G.G. e-mail: ggr@ipmce.ru . ...

Еще в разделе: (Показать все результаты (>307) - num-meth.srcc.msu.ru/ )

• "Performance evaluation of breadth-first search on Intel Xeon Phi"
• "Implementation of the Lagrangian approach to the description of gas-particle
• A parallel algorithm for computing surface currents in a screen electromagnetic

... Along with the stable inner proton belt, temporal variations of the 1-15 MeV protons at L=2.5-3.5 have been reported, with intensity increases and decreases registered during and after strong magnetic storms. ... Our study presents experimental evidences that creation and destruction of solar proton belts in the inner magnetosphere may be produced by the fast shifts of the proton penetration boundary without additional acceleration and injection. ... Black line shows the 50-90 MeV proton profiles. ...

Еще в разделе: (Показать все результаты (>129) - www.kosmofizika.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus

... Acoustic Currents and Whirlwinds in Helmgoltz Resonators . ... Supervision of acoustic currents and whirlwinds in single Helmholts resonators under the influence of an intensive sound on resonant frequences   is considered. ... We studied a configuration of acoustic currents in Helmholtz resonators on its own resonant frequency. The air stream is involved in the resonator along the internal surface of the intake tube   and goes out along the longitudinal   axis of the same resonator's tube. ...

Еще в разделе: (Показать все результаты (>592) - acs366.phys.msu.su/ )

... Snecma Moteurs (Groupe Snecma, France) . ... The Colloquium-458, organized by EUROMECH , will take place at Institute of Mechanics of Lomonosov Moscow State University (MSU) . ... The subjects of the Colloquium-458 cover important problems dealing with the verification of constitutive equations, the organization of experiments, the connection between microstructures and mechanical properties and the effective utilization of the modern FEM packages. ... France. ... S.-Petersburg State Techn. ...

Еще в разделе: (Показать все результаты (>3) - www.imec.msu.ru/ )