At study of anisotropic media with the help of azimuthal resistivity survey prof. A.S.Semenov has recommended to apply dipole equatorial array or any other non-linear array. Arrays with electrodes' position not in one line ( non-linear arrays ) have higher sensitivity to anisotropy in comparison with linear (or collinear) arrays (Schlumberger, AM, AMN). The most simple example of non-linear array is dipole equatorial (D) array. ... As T - array it has two MN lines with one common M electrode. ...

Еще в разделе: (Показать все результаты (>9) - geophys.geol.msu.ru/ )

... joint multiview video encoding in consideration of inter view information redundancy (e.g. H.264 MVC amendment) . encoding of 2D and depth with further multiview generation . ... H.264 Reference software for Multiview Video Coding (JMVC 8.5) was used for single-view and multiview compression . JPEG2000, x264, Xvid for depth key frames compression . ... Keyframe-based Depth Compression (Update) . Keyframe-based Depth Compression with Depth Propagation for Multiview Video Coding . ...

Еще в разделе: (Показать все результаты (>27) - graphics.cs.msu.ru/ )

• Robust Matching of Aerial Images with Low Overlap | Graphics and Media Lab
• Gleb Krivovyaz | Graphics and Media Lab
• Lossless Video Compression (MSU Lossless Video Codec) | Graphics and Media Lab

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>38) - qilab.phys.msu.ru/ )

... форумы . ... Флогистон / Психологические форумы / Психологический форум на "Флогистоне". Презентация про математические методы в психологии (англ.) (1705 просмотра) . ... Amice . Написано: 2010-10-22 12:33 . ... У кого есть время, силы и мотивация - поддержите мою презентацию на World's Best Presentation Contest 2010. Презентация посвящается математическим методам в психологии. ... If you need that presentation you can write me a letter with your e-mail. ...

Еще в разделе: (Показать все результаты (>7) - www.flogiston.ru/ )

... Next: SPM Control Up: Image formation and processing Previous: Scan lines averaging Contents Index . ... That is why small objects are unnoticeable in compare with big ones on the images in which object height is represented by colours. ... There is a way to combine information about objects height with the information about height of small detail on its surface. ... Thus, applying this highlight effect to surface image will reveal small details without losing information about the big ones (see pic...

Еще в разделе: (Показать все результаты (>12) - www.spm.genebee.msu.ru/ )

• Plane tab

Cosmic Research, Vol. 42, No. 5, 2004, pp. 435­488. Translated from Kosmicheskie Issledovaniya, Vol. 42, No. 5, 2004, pp. 453­508. Original Russian Text Copyright © 2004 by Veselovsky, Panasyuk, Avdyushin, Bazilevskaya, Belov, Bogachev, Bogod, Bogomolov, Bothmer, Boyarchuk, Vashenyuk, Vlasov, Gnezdilov, Gorgutsa, Grechnev, Denisov, Dmitriev, Dryer, Yermolaev, Eroshenko, Zherebtsov, Zhitnik, Zhukov, Zastenker, Zelenyi, Zeldovich, Ivanov-Kholodnyi, Ignat'ev, Ishkov, Kolomiytsev, Krasheninnikov, Kudela,

Еще в разделе: (Показать все результаты (>2) - solarwind.cosmos.ru/ )

• http://www.kosmofizika.ru/buri/pansyketal.pdf

... BMC Genomics 2013, 14:476 http://www.biomedcentral.com/1471-2164/14/476 RESEARCH ARTICLE Open Access The miniature genome of a carnivorous plant Genlisea aurea contains a low number of genes and short non-coding sequences Evgeny V Leushkin1,2, Roman A Sutormin1, Elena R Nabieva1, Aleksey A Penin and Maria D Logacheva1,5* 1,2,3 , Alexey S Kondrashov 1,4 Abstract Background: Genlisea aurea (Lentibulariaceae) is a carnivorous ... Second, loss of genes could be involved. ... Plant Biol. ...

Еще в разделе: (Показать все результаты (>3) - storage.bioinf.fbb.msu.ru/ )

Economic, industry and corporate trends A report from the Economist Intelligence Unit sponsored by Cisco Systems Foresight 2020 Economic, industry and corporate trends Contents Preface Executive summary Chapter 1: The world economy Chapter 2: Industries Automotive Consumer goods and retailing Energy Financial services Healthcare and pharmaceuticals Manufacturing Public sector Telecoms Chapter 3: The company Appendix I: Survey results 2 3 6 22 24 30 36 43 50 57 62 67 74 86 Appendix II: Methodology for

Еще в разделе: (Показать все результаты (>2) - bc.fdo.msu.ru/ )

New Developments in VertexReco Rudi FrЭhwir th, Kirill Prokofiev, Thomas Speer, Pascal Vanlaer, Wolfgang Waltenberger . ... NoPU 1 4 - NoPU 24 New Developments in Vertex Reconstruction ­ p.16/24 PCLMSFit - resolution in x Entries pclmse 485 0.0004564 0.01911 39.44 / 49 Mean RMS 2 / ndf - pulls in x 400 350 300 250 200 150 Entries Mean RMS pclmse 499 -0.03713 0.63 60 50 40 30 20 Constant_BG 47.83 ± 3.958 Mean _BG -0.0001747 ± 0.0004007 Sigma_BG Constant ...

Еще в разделе: (Показать все результаты (>15) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/radchenko/MolecularTiggersforInternet.doc

... Recently, the 579-nucleotidelong 5 untranslated region (UTR) of RhPV has been shown to contain an internal ribosome entry site (IRES) that functions efficiently in mammalian, plant, and insect in vitro translation systems. Here, the mechanism of action of the RhPV IRES has been characterized by reconstitution of mammalian 48S initiation complexes on the IRES from purified components combined with the toeprint assay. ... Purification of 40S ribosomal subunits, initiation factors, and Met-tRNAiMet. ...

Еще в разделе: (Показать все результаты (>51) - www.genebee.msu.ru/ )

• http://www.genebee.msu.ru/LPSR/Dmitriev_MCB2007.pdf
• http://www.genebee.msu.ru/LPSR/Dmitriev_MCB2003.pdf
• AliComp - GeneBee Alignment Comparison Help

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>6) - anazarenko.ffl.msu.ru/ )

• Бродецкая Александра

I. S. MAMAEV Institute of computer science 426034, Russia, Izhevsk Universitetskaya St., 1 E-mail: mamaev@rcd.ru NEW CASES WHEN THE INVARIANT MEASURE AND FIRST INTEGRALS EXIST IN THE PROBLEM OF A BODY ROLLING ON A SURFACE Received September 16, 2003 DOI: 10.1070/RD2003v008n03ABEH000249 Some new cases when the invariant measure and an additional first integral exist in the problem of a rigid body rolling on a sphere and on an ellipsoid are discussed in the paper. ... Rolling of a ball on a surface. ...

Еще в разделе: (Показать все результаты (>39) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/d07/157-isomorphisms-of-geodesic-flows-on-quadrics_en.pdf
• Institute of Computer Sciences - Publications

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

... These CDD-NDs are produced by specific acid treatment of detonation soot, forming tiny rounded sp2 carbon species (carbon dots), 1­2 atomic layers thick and 1­2 nm in size, covalently attached to the surface of the detonation diamond nanoparticles. ... In this paper, we report that specific acid treatment of NDcontaining detonation soot, produces tiny rounded sp2 carbon species (carbon dots), which are 1­2 atomic layers thick and covalently attached to the surface of DND particles. ... Figure 4. ...

Еще в разделе: (Показать все результаты (>7) - rswater.phys.msu.ru/ )