... Department . ... Courses . ... Course Name . ... Prof. Fedor S. Zaitsev . ... Prof. Alexander M. Popov . Visualization in Scientific Research . ... Assoc. Prof. Igor N. Inovenkov . Mathematical Models for Dynamic Processes . ... Prof. Vladimir V. Nefedov . ... Prof. Igor V. Zotov . ... One-Dimensional Problems of Mathematical Physics . ... Prof. Alexander P. Smirnov . Two-Dimensional Problems of Mathematical Physics . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>13) - ani.cmc.msu.ru/ )

• Department of the Automation for Scientific Research CMC MSU | Computational
• The ASR Department at the CMC Faculty of Lomonosov MSU | Department of the
• Prof. Dmitry P. Kostomarov at the Differential Equations and Topology

... Приз в 1 миллион долларов за решение каждой из семи математических проблем . ... Научная лаборатория школьников . ... CMI - The Clay Mathematics Institute (Кембридж, Штат Массачусетс) - назвал семь нерешенных математических проблем - "Millennium Prize Problems", за решение каждой из которых будет выплачен $1 млн. К . 16.01.2003 Проблема Кука . ... Научная Сеть . ...

Еще в разделе: (Показать все результаты (>156) - www.nature.web.ru/ )

• На следующей неделе в Протвино состоится 24-я Международное совещание по физике
• Theoretical Computer Science: взгляд математика
• Приз в 1 миллион долларов за решение каждой из семи математических проблем

. Name . Last Modified . Size . Type . Parent Directory / . - . Directory . asm / . 2016-Feb-21 14:32:38 . - . Directory . atmos / . 2015-Dec-21 19:17:42 . - . Directory . avrup / . 2010-Apr-24 21:34:09 . - . Directory . mirror / . 2009-Dec-06 17:57:48 . - . Directory . rs485 / . 2015-Feb-03 20:07:40 . - . Directory . sv / . 2009-Nov-26 18:26:21 . - . Directory . turbina / . 2009-Nov-26 18:14:43 . - . Directory . lighttpd/1.4.37

Еще в разделе: (Показать все результаты (>32) - curl.sai.msu.ru/ )

• Index of /pub/mirror/
• Index of /pub/mirror/suse/
• Index of /pub/atmos/

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>4) - tukachev.flogiston.ru/ )

... Alexey D. Neverov . ... Department of Bioengineering and Bioinformatics, Moscow State University. State Scientific Center GosNIIGenetika. ... EDAS human . EDAS mouse . EDAS dog (not availible now) . EDAS rat (not availible now) . To navigate this site please install the latest version of Macromedia Flash Player for Windows or for Linux . If you do not wish to install Flash you could use text pages with less functionality. ...

Еще в разделе: (Показать все результаты (>5) - edas2.bioinf.fbb.msu.ru/ )

• EDAS (human) - Alternative Splicing DataBase.
• EDAS (mouse) - Alternative Splicing DataBase.
• Index of /dog

... If this bit of homework finds be also mind-boggling, contemplating working through on line wholesale directory like Salehoo to support in your lookup. ... celine outlet italia , because these brands are high quality and put on weight no need to re-emphasize that unless they?re selling high resolution replica bags or issue. burberry bag charm in along with large wholesale fashion designer bags. ... 2016 С Днем Победы! ...

Еще в разделе: (Показать все результаты (>77) - elana.sinp.msu.ru/ )

• ralph lauren outlet uk 6 million cars worldwide | С Днем Победы!
• the north face outlet uk Legner said that companies should provide an automated
• editor | С Днем Победы!

Anisotropy of Cosmic Rays. Origins, experiments, data analysis problems & methods. ... ANTARES problems and methods. ... 2D» experiments Name Tibet Air Shower Array Position 90.522o E, 30.102o N; 4300 m above sea level 30.11 N, 4300m a.s.l. Gran Sasso, 2000m Caucasus, 1700m (40deg N, 113 deg W), atmospheric depth of 860 gm/cm2 Energy 4,6.2,12,50, 300 TeV Gamma /CR mix Time 1997-1999 TibetII, 1999-2001 TibetIII (bigger HD array). 4 years 1 year Statistics 7x109 in ~1000 days Rate Ang. ...

Еще в разделе: (Показать все результаты (>14) - antares.sinp.msu.ru/ )

SEISMIC DATA INTERPRETATIO N Graduate program "Applied Tectonics and Dynamic&Structural Geology" is intended for advanced studies in the classical chapters of Tectonics TECTONICS AND GEOLOGICAL and used to solve applied geological problems. All major areas, such as ANALYSIS FOR EXPLORATION Tectonics, Structural Geology, Geological Interpretation of the Geophysical Data and practical approaches for applied geological analysis, are covered by this graduate program. ...

Еще в разделе: (Показать все результаты (>21) - dynamo.geol.msu.ru/ )

Lomonosov Moscow State University, Faculty of Mechanics and Mathematics, English Department On Borsuk's problem by A. Lukina, group 305, English teacher: A.A.Savchenko 1. ... It studies combinatorial properties of finite or discrete bodies or bodies with some particular characteristics, for instance, of a certain diameter. ... A number of questions arise from this problem. ... It is useful to deal with not just a body of diameter one, but with its approximation, called universal cover system. ...

Еще в разделе: (Показать все результаты (>21) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part3.pdf
• http://www.eng.math.msu.su/download/theses3.pdf

Invisible Higgs in weak bosons associative production with heavy quarks at LHC Sergei Demidov Institute for Nuclear Research RAS in collaboration with E. Boos (SINP MSU) and D. Gorbunov (INR RAS) 9 September, 2010 E. Boos, D. Gorbunov, S. Demidov (INR RAS) Invisible Higgs 9 September, 2010 1 / 15 Introduction Standard Model. ... 2003) Why does missing pT come from Higgs boson? ... V via q q VV scattering where q is Higgs mass range mH < 2MV , vir tual Higgs, probing the Higgs width H . ...

Еще в разделе: (Показать все результаты (>110) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2015/Chesnokov_QFTHEP%202015.pdf
• http://qfthep.sinp.msu.ru/talks2011/APopov_doklad.pdf
• http://qfthep.sinp.msu.ru/talks2011/nekrasov.pdf

... This 0.5 - year course is devoted to the principles of mathematical modeling in human investigation on physical, economical and social natures. ... Modern Operating Systems . ... This is introductory course to computer network technologies. ... It covers vary basically ISO OSI RM, TCP/IP protocol stack, Ethernet and WiFi principles, core network technologies, PSTN and GSM, main threats and vulnerabilities, and also popular cryptographic technologies and secure network protocols. ...

Еще в разделе: (Показать все результаты (>18) - hcs.cmc.msu.ru/ )

• Mathematical Models of Complex Systems: Theory, Algorithms, Applications |
• Master program "Mathematical Models of Complex Systems" | Магистерское и
• Master program "Information Security and Cryptography" | Магистерское и

... Студенческая Астрономическая обсерватория ГАИШ . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... For those really interested in galaxies, extragalactic astronomy or the aspects of cosmology we study, we can always find an interesting problem to work on. ... To make your work in the Group most effective, it would be useful to study the following courses read by our group members as well as the members of other groups in our and other institures. ... Student information . ...

Еще в разделе: (Показать все результаты (>24) - www.sai.msu.ru/ )

• Index of /groups/cluster/gcvs/digit/mdv
• Index of /groups/cluster/gcvs/digit
• Index of /groups/cluster/gcvs/digit/preprint.files

... Plenary talk by Yu.G. Evtushenko (CCAS RAS) "Effective methods for solving of large-scale optimization problems" Chair I.G. Pospelov : .. ... Plenary talk by V.V. Podinovsky (NRU HSE) "Criteria importance theory: state-of-the-art" Chair A.V. Lotov : . ... Plenary talk by Yu.V. Dorn, A.V. Gasnikov*, Yu.E. Nesterov, S.V. Shpirko "The Three-Stage Version of Stable Dynamic Model" Chair Yu.E. Nesterov 355 113 2 2 2 2 2 ( ) 10:00 11:00 11:30 14:00 15:15 18:00 « » (, , 17 , , 526) 11:10-13:50, .. ...

Еще в разделе: (Показать все результаты (>16) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2007/template_eng.doc
• http://io.cs.msu.ru/ORM2013/FINAL/Program_ORM2013_ENG.pdf
• Кафедра Исследования Операций

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

... Class . ... FIELD | ... METHOD . ... public interface NetcdfService . ... This service provides a way to 'open' remote Netcdf data sets by name. ... list () . ... Field Detail public static final java.lang.String SVC_NAME . ... If the name is not the same as one obtainable from the list() opteration on this service, then this method will fail. ... NetcdfRemoteProxy which can be used to create an instance of RemoteNetcdf. public java.lang.String[] list () throws java.rmi.RemoteException . ...

Еще в разделе: (Показать все результаты (>44) - angel.cs.msu.su/ )

• Index of /~oxana
• Index of /~oxana/image_processing
• Index of /~oxana/prac/task2/.svn

... C haos theory, c omplex systems, fractals, secure communication by chaos, nonlinear economical problems, theory of billiards, fibrillation in the cardiac tissue, prediction problem of nonlinear processes. ... Dynamical Chaos and Applications . Billiards . Controlling chaotic systems and Supression of chaos . Time series analysis . ... Bifurcation theory . Modelling cardiac arrhythmias . ...

Еще в разделе: (Показать все результаты (>67) - chaos.phys.msu.ru/ )

• Research interests
• Staff

. # ....... # S ....... S T ..... E R . Q U E . C N ..... T C ....... U # ....... R E ..... E S . S .

Еще в разделе: (Показать все результаты (>7241) - mouse.belozersky.msu.ru/ )

• Index of /npidb/pdb
• Index of /npidb/pdb/pdb_new/scop_contact_type
• Index of /npidb/data/pdb_new

... We discuss the calculation of the d.c. conductivity of granular metals on the insulating side of the metal--insulator transition. The granular structure is represented by a fractal percolation cluster and the problem of virtual tunneling-assisted conductivity is shown to be related to estimating the number of minimal paths for the problem of chemical distance metric on the fractal. ...

Еще в разделе: (Показать все результаты (>40) - scon155.phys.msu.su/ )

• Photoelectric phenomena and metastable states in amorphous semiconductors
• Theory of electronic properties of disordered semiconductors and systems with

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... Reactivity thermoelectric clathrate compounds in interaction with components of the air . The project aims to address the fundamental problems of solid state chemistry - revealing the fundamental regularities of the reactivity of crystalline phases in reactions with air components and processes of formation of oxide layers (coatings) for new materials. ...

Еще в разделе: (Показать все результаты (>23) - www.lssm.inorg.chem.msu.ru/ )

General Information . ... Local Information . ... The city represents great cultural value because in the late 19th and early 20th centuries, Kislovodsk as a fashionable spa attracted many musicians, artists, and members of the Russian aristocracy. ... Double room with full pension (breakfast, lunch, dinner) - 2620 rubles per person per night. solnechniy . ... Citizens of most countries need visa to enter the Russian Federation. ... Victor Kornilov, Sternberg Astronomical Institute (chair) . ...

Еще в разделе: (Показать все результаты (>11) - site2010.sai.msu.ru/ )