... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>16) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

BNL PREPRINT BNL­QGS­98­0501 Study of Ї pp Baryon Exchange Processes V. L. Korotkikh 1;2 June 25, 1998 abstract The cross­section of the process Ї p + p ! ... ъ + + ъ \Gamma We repeated Barger and Cline's [3] calculation of reaction (3) and received the same 2 results at 10 GeV with their parameters: fi \Delta 8ъ = 0:10 GeV \Gamma1 ; s 0 = 2:85 GeV 2 ; ff \Delta (u) = 0:15 + 0:9 u: (5) The differential cross­section depends on these parameters as dЇoe du = 389:3 Їb ъ 2 s / fi \Delta 8ъ ! ...

Еще в разделе: (Показать все результаты (>69) - lav01.sinp.msu.ru/ )

• Home Page of L. Sarycheva
• Home Page of I. Lokhtin
• Home Page of A. Demianov

. [ Войти ] . Главная -> Фильмы -> Category 7: The End of the W.. Пользователи . Демо . Деньги . Фильмы . Форум . Category 7: The End of the World . Германия - США 2005 . отметить . Триллер . Боевик . Dick Lowry . Sebastian Spence . Tom Skerritt . Kenneth Welsh . James Brolin . Cameron Daddo . Randy Quaid . Suki Kaiser . Robert Wagner . Nicholas Lea . Swoosie Kurtz . Gina Gershon . Adam Rodriguez . Shannen Doherty . Lindy Booth . John Kapelos .

Еще в разделе: (Показать все результаты (>48) - kinfo.ru/ )

• Category 6: Day of Destruction - Фильмы - Kinfo.ru
• Particles of Truth - Фильмы - Kinfo.ru

Dear Colleagues, As you know, JENAM-2007 will take place in Yerevan, Armenia. ... JENAM-2007 will consist of 6 Plenary sessions (invited reviews on hot topics of modern astrophysics, 8 EAS Symposia, and 7 Special Sessions (SPS). ... The opening and closing sessions, EAS symposia and special sessions will be organized in the conference halls and auditoria of the Yerevan State University (YSU). ... The proceedings of the JENAM-2007 will be published in the EAS proceedings series in 2008. ...

Еще в разделе: (Показать все результаты (>111) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).
• Subject: Registration now open for the "European Week of Astronomy and
• International School "Frontiers in Numerical Gravitational Astrophysics"

SITE 2010 Comprehensive Characterization of Astronomical Sites Kislovodsk, Russia, 49 October 2010 Conference Summary Marc S. Sarazin*a a European Southern Observatory, Garching, Germany Abstract The main topics discussed during the Site 2010 conference are outlined and the outcome is described. Keywords: Astronomical Site testing, precipitable water vapor, atmospheric turbulence, cloudiness, seeing 1. ... Site surveys for National observatory projects in China, India, and Iran benefit from this. ...

Еще в разделе: (Показать все результаты (>10) - site2010.sai.msu.ru/ )

... Department of Mathematics, . Faculty of Physics, MSU . ... Mathematical analysis 2 . Numerical Methods (A.N. Bogolyubov) . ... Asymptotic methods in nonlinear problems of mathematical physics . ... Extremal problems . ... Methods of finite differences in mathematical physics . ... 13 th Annual workshop will be organized by the of Department of Mathematics of Physics Faculty at Moscow State University , Moscow, Russia. ... Department of Mathematics, Faculty of Physics, Lomonosov MSU 2014-2016 ...

Еще в разделе: (Показать все результаты (>7) - math.phys.msu.ru/ )

... Выпускники . ... Женский клуб . ... Издательство МГУ . ... Итак, в каких же продуктах найти антиоксиданты, защищающие наши клетки от старения и сохраняющие нам молодость? Норвежские ученые предлагают на выбор свыше трех тысяч 'эликсиров молодости' на любой вкус. ... Our objective was to develop a comprehensive food database consisting of the total antioxidant content of typical foods as well as other dietary items such as traditional medicine plants, herbs and spices and dietary supplements. ...

Еще в разделе: (Показать все результаты (>177) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Миланские ученые нашли путь к долголетию с помощью
• Клуб выпускников МГУ: В крови нашли 22 биомаркера старения

Russian Interdisciplinary . Temporology Seminar: . ... 1984-2010. ... On the Institute . ... Journals about time . ... Time as a physical structure. ... On the problem of psychological time. ... The Chinese classic "Book of Changes" and archaic construction of time. ... The problems of microbiological time. ... On the problem of musical time. ... Multidimensional space-time and physical interactions. ... Problems of time and methodological problems of quantum mechanics. ...

Еще в разделе: (Показать все результаты (>511) - chronos.msu.ru/ )

• GENERATING FLOWS AND A SUBSTITUTIONAL MODEL OF SPACE-TIME

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>22) - lcl.srcc.msu.ru/ )

. Home . Main information . History . Gallery . People . Our Research . Photonics . Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . Neurophotonics . Nonlinear optics of ionized mediums . Fiber lasers . Collaborations . Publications . Conferences . Grants . Video . Contacts . Laboratory of photonics and nonlinear spectroscopy . Back to Category Overview . Previous . Next . Home Конференции Санкт-Петербург . Powered by Joomla! . Valid XHTML and CSS .

Еще в разделе: (Показать все результаты (>23) - photonicslab.phys.msu.ru/ )

• Gallery - Category: Конференции - Image: Казань ICONO/LAT 2010, дорога туда=)
• Gallery - Category: Конференции - Image: Казань ICONO/LAT 2010
• Gallery - Category: Конференции - Image: LALS, Oulu, Finland 2010

6 апреля 2004 . ... Группы инерции гладких вложений. Классическим и очень интересным объектом дифференциальной топологии является группа $C^k_n$ гладких вложений $S^n$ в $S^{n+k}$ (с точностью до гладкой изотопии). ... Тогда для любых (возможно, не изотопных) вложений $g_1,g_2:S^4\to S^7$ вложения $f\#g_1,f\#g_2:N\to S^7$ изотопны. ... Пусть $f:N\to S^7$ --- гладкое вложение, которое почти гладко изотопно гладкому вложению с образом в $S^6\subset S^7$. ...

Еще в разделе: (Показать все результаты (>118) - higeom.math.msu.su/ )

• Algebraic topology abstracts (Russian)
• Resources (Russian)
• Bookmarks for asmish

... We consider the mathematical models of the bio-populations homogeneous in space and time. The stochastic dynamics of such populations includes the birth and death processes, the migration and the immigration. ... We prove the existence of the limiting distribution, which in the dimension d = 2 requires either a very active migration or a very active immigration. ... The class of the models under consideration includes continuous "contact model" which was introduced and studied recently by Yu. ...

Еще в разделе: (Показать все результаты (>32) - new.math.msu.su/ )

• http://new.math.msu.su/content_root/programs/kaf/special/vichmat/teor-af.doc

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Magnetospheric particles and radiation conditions . ... Scientific equipment . ... Scientific payload of the ?Lomonosov? satellite will include a complex of the devices ELFIN-L and DEPRON for the studies of the processes of the charged particles penetration into the upper atmosphere of the Earth and for the analysis of the radiaiton conditions at low altitudes. ...

Еще в разделе: (Показать все результаты (>61) - lomonosov.sinp.msu.ru/ )

• ELFIN-L | Университетский спутник "Ломоносов"
• Gamma-bursts | Университетский спутник "Ломоносов"
• Scientific goals | Университетский спутник "Ломоносов"

. Deprecated : mysql_connect(): The mysql extension is deprecated and will be removed in the future: use mysqli or PDO instead in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Warning : mysql_connect(): Can't assign requested address in /wcmc/lms/lms/includes/database.mysql.inc on line 31 . Can't assign requested address

118. Molecular aspects of solid state and interfacial electrochemistry

119. Ученые ? детям: Course categories

120. Category: полезные советы