The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>9) - www.rlcentre.com/ )

V Russian-Dutch Workshop "Work Incentives in Russian Industry, 1861-2000: Compensation, Commitment and Coercion" Moscow, September 13-14, 2002 Conference Room (652), Faculty of History, Moscow Lomonosov State University Programme of the Workshop Friday, September 13 Opening session. ... Evolution of Work Incentives in the Russian Metalworking Industry: Case Studies Chair: Andrey Sokolov 14:30-15:15. Andrey Markevich (Institute of Russian History of the Russian Academy of Sciences IRH RAS). ...

Еще в разделе: (Показать все результаты (>37776) - hist.msu.ru/ )

• Project "The Labour Relations Evolution in Russian Industries"
• Department of Source Studies of Russian and Soviet History
• Department of Archaeology

Some additional inquiry information . ... help information) . Here you can read some articles, describing details of calculting process. We hope, after having these articles read, you'll surely know, what and how does this program work. Alignment formats . ... WPGMA - method for sequence weighting and tree constructing . Alignment quality estimation: "The rule of fours" . Phylogenetic tree schemes . Criteria of branch quality . Evolution reconstruction: parsimony method . ...

Еще в разделе: (Показать все результаты (>279) - monkey.belozersky.msu.ru/ )

• Molecular biology databases

This is where Foswiki keeps system documentation, including documentation that is included with optional extensions. For most people, the System web is read-only; even administrators should not need to modify any of the topics here, though you may want to add your own topics - for example, to answer frequently asked questions from your users. ... Server side include . To include the contents of a web page or Foswiki topic, use %INCLUDE{"page"}%. ... This topic: System > WebHome . ...

Еще в разделе: (Показать все результаты (>48964) - wiki.cmc.msu.ru/ )

• (backlinks in System Web) PageCaching < System < Foswiki
• (backlinks in all Webs) MailerContrib < System < Foswiki
• (backlinks in System Web) MailerContrib < System < Foswiki

... Спецкурс Методы управления транзакциями в современных СУБД . ... Аудитория: студенты кафедр СП, АСВК и АЯ, 3-5 курсы, также студенты 1-2 курса, интересующиеся тематикой курса. ... Курс знакомит слушателей с различными аспектам управления транзакциями в централизованных и распределенных СУБД. ... C. Mohan, D. Haderle, P. Schwarz, "ARIES: A Transaction Recovery Method Supporting Fine-Granularity Locking and Partial Rollbacks Using Write-Ahead Logging", ACM Transactions on Database Systems, Vol. ...

Еще в разделе: (Показать все результаты (>211) - sp.cs.msu.ru/ )

• Logic and Databases
• Explicit cyclic schemes for space neutron kinetics in (Hex-Z) geometry

Backlinks to PageCaching in all Webs ( Search System Web only ) . ... A List of Wiki Administrator Documentation $ AccessControl : Restricting read and write access to topics and webs, by users and groups $ TopicUserMappingContrib .. NEW - 22 Nov 2010 - 01:48 by ProjectContributor . ... NEW - 21 Sep 2011 - 13:50 by ProjectContributor . ... NEW - 06 Dec 2010 - 17:08 by ProjectContributor . ... NEW - 02 Feb 2011 - 12:30 by ProjectContributor . Number of topics: 4 . ...

Еще в разделе: (Показать все результаты (>23263) - wiki.cs.msu.ru/ )

• (backlinks in System Web) MailerContrib < System < Foswiki
• (backlinks in all Webs) MailerContrib < System < Foswiki
• (backlinks in System Web) PageCaching < System < Foswiki

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>21) - mouse.genebee.msu.ru/ )

• About

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ Recommendations of the International Workshop "Local Tsunami Warning and Mitigation" Petropavlovsk-Kamchatskiy, Russia, September 10 - 15, 2002 Analysis of the state-of-the-art of the local tsunami participants testifies to the potential of a significant methodology and hazard reduction. ...

Еще в разделе: (Показать все результаты (>33) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information
• LOCAL TSUNAMI WARNING AND MITIGATION

Bird Species Database (BSD) is being compiled in a framework of the Arctic Birds Breeding Conditions Survey (ABBCS) of the International Wader Study Group (IWSG). BSD aims at providing information on distribution, numbers and breeding status of birds in the Arctic, with the focus on last-breaking and, thus usually unpublished information. The primary source of data is questionnaires filled in by contributors to the ABBCS, while data from literature are being added occasionally. ... breeding . ...

Еще в разделе: (Показать все результаты (>3) - arctic.ss.msu.ru/ )

... Новости . ... Лаборатории . ... Оценка и экспертиза почв . ... создать лабораторию экологического почвоведения в составе кафедры географии почв. ... Наибольший интерес вызвало последнее занятие, интегрированное в Парад почв, организованный совместно с факультетом почвоведения МГУ. ... С глубоким прискорбием сообщаем о скоропостижной кончине заведующего лабораторией биоразнообразия почв Института экологического почвоведения МГУљчлен-корреспондента РАН, профессора Чернова Ивана Юрьевича. ...

Еще в разделе: (Показать все результаты (>2) - soilinst.msu.ru/ )

... Scientific conference . ... International recognition of this outstanding woman and scientist serves as a wonderful example for the young people who have chosen chemistry as the basis for the carrier, and makes it possible to commemorate the important contribution of women in the development of chemistry as a science.  ... Especially in Russia women received possibility of professional realization in chemical science and education through  different ways starting from 1870’s on. ...

Еще в разделе: (Показать все результаты (>157) - www.chem.msu.ru/ )

... Boris A. Grishanin is an Associate Professor in the Department of Physics, M.V.Lomonosov Moscow State University (MSU). He received his M.S. and Ph.D. degrees from MSU in 1963 and 1968, respectively (both in Physics). ... B. A.Grishanin's current research interests are in the field of quantum theory of open systems, laser physics, molecular dynamics of photoexcited molecules, problems of quantum information and quantum computing. ... Information theory . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>98) - qilab.phys.msu.ru/ )

... Upstream open reading frames regulate translation of the long isoform of SLAMF1 mRNA that encodes costimulatory receptor CD150. ... More than 40% of human genes contain upstream open reading frames (uORF) in their 5'-untranslated regions (5'-UTRs) and at the same time express at least one truncated mRNA isoform containing no uORF. ... CD150 is a member of the CD2 superfamily, a costimulatory lymphocyte receptor, a receptor for measles virus, and a microbial sensor on macrophages. ...

Еще в разделе: (Показать все результаты (>125) - biochem.bio.msu.ru/ )

... All rights reserved finmen.spa@mail.ru : : hcp://spa.msu.ru/page_325.html : hcp://vk.com/mh_msu_fgu_finance .. ... All rights reserved / () · : · : LIBOR ( London Interbank Offered Pate), MIBOR ( Moscow Interbank Offered Pate) · :LIBID (London Interbank Bid), MIBID (Moscow Interbank Bid) · : MIACR (Moscow Interbank Ac·al Credit Rate) · : Prime- rate, Mosprime- rate .. ... All rights reserved · ­ , t i B ­ D =- - - - - - - - - - - - - - t - 360 i - , 100% · .. ... All rights reserved · , · APR ­ , . ...

Еще в разделе: (Показать все результаты (>1055) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/bakalavriat/lecture_2702_finance_analysis.pdf
• The 14th International Conference 'Public Administration of the Russian
• Содержание выпусков

... Institute of Mechanics . ... In 1977- 1991 A .P.Seyranian was a Member of Scientific Staff at the Institute of Problems in Mechanics of the Academy of Sciences in Moscow . ... Since 1993 A .P.Seyranian is a Leading Researcher and Professor of the Institute of Mechanics , Moscow State Lomonosov University . ... In 2003 he became an Invited Speaker and Chairman of the Session 'Stability and Control Problems in Mechanics' at the conference 'Physics and Control 2003' , Sankt-Petersburg. ...

Еще в разделе: (Показать все результаты (>4) - seyranian.imec.msu.ru/ )

• List of Publications of Prof. Alexander P. Seyranian

. У вас отключен javascript. Включите его, пожалуйста

117. http://physcontrol.phys.msu.ru/materials/aal/CV_Lazarev_2012.pdf

118. The Database of Close Binary Systems

119. Draft Plan of Action for Eurasian Subregional Partnership | ECFS

120. MSM 2007