GSK-3 Inhibitors: The Dataset . ... We suppose that it will be useful for the other researchers in the field of chemoinformatics; the main peculiarity of this Dataset is wide activity range of compounds and significant diversity of the actives (true inhibitors). ... IC50 is given in nM (sic!) according to the data reported in the article. It's a text field (as well as the other raw activity data fields) and values like '>10000' are given for inactive compounds. ...

Еще в разделе: (Показать все результаты (>4) - qsar.chem.msu.ru/ )

... About lab . ... Projects . ... Online Journal "Computer graphics and multimedia" (in russian) . ... VQMT3D (Video Quality Measurement Tool 3D) project was created to improve stereoscopic films. ... VQMT3D project is currently being developed. ... Scale Mismatch . ... S3D shooting quality analysis of 5 movies . ... 2D-3D conversion quality analysis of 5 movies . ... Rotate Analysis, Temporal Shift, Channels Swap, Zoom Mismatch in 25 movies . ... Report 1 ( S3D shooting quality analysis of 5 movies) ....

Еще в разделе: (Показать все результаты (>187) - graphics.cs.msu.ru/ )

• VQMT3D Project | Лаборатория компьютерной графики и мультимедиа
• Video Matting Benchmark | Graphics and Media Lab Equation Equation Equation
• GML LidarK Library | Graphics and Media Lab

The use of the external module Ab_An.dll Ab_An.dll file is an external module for the Gibbs program, and is designed to calculate the activity coefficients of the components of albite- anortite solid solution. ... A non-ideal model of albite-anortite solid solution, proposed in literature [1], is used in this module. ... Preparation of the System file To be able to use the module Ab_An.dll, you need to include a binary solid solution of albite and anortite into the System file, as you create it. ...

Еще в разделе: (Показать все результаты (>72) - www.geol.msu.ru/ )

• http://www.geol.msu.ru/deps/geochems/soft/en/Electrum.doc
• Software for resistivity and induced polarization
• Faculty of geology Moscow State Lomonosov University

N owadays, Faculty of Physics includes 7 divisions (experimental and theoretical physics, solid state physics, radiophysics, nuclear physics, geophysics, astronomy, and complimentary education), which fall into 38 chairs. T he faculty?s staff consists of about 1400 employees including faculties, research and technical staff, and administration. Among faculties there are 265 and 235 members with PhD and DrSc (Doctor of Sciences) degrees, respectively, and over 100 full professors. ...

Еще в разделе: (Показать все результаты (>21) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure
• Your comments about our cite
• Postdoctoral training (General Physics and Wave Processes)

... Юрий (admin) Новости R , полезные советы , работа с данными No Comments . ... Юрий (admin) Новости R , анализ и визуализация данных , большая пятерка , корреляция , представление результатов , психометрика , статистика No Comments . ... Юрий (admin) Новости виртуальные исследования , опросы , психологические исследования No Comments . ... Юрий (admin) Новости ассессмент , виртуальные исследования , исследования , опросы , оценка персонала , центр оценки No Comments . ... ЖЖ-сообщество ?RU_SPSS? ...

Еще в разделе: (Показать все результаты (>170) - tukachev.flogiston.ru/ )

• Tag: SPSS Evaluation Version
• Tag: R
• Tag: SPSS

... Our primary objective is the design and implementation of applied software tools for data processing, output and circulation of computer literature. ... Software tools for signal processing in medicine and engineering CONAN-m and CONAN-t. Statistical stable analysis tool for regression and factor models SIGN. ... Figurnov V.A. "IBM PC for Users" (in Russian). ... Boldin M.V., Simonova G.I., Tyurin Yu.N. "Sign Statistical Analysis of Linear Models" (in Russian and in English ). ... InCo . ...

Еще в разделе: (Показать все результаты (>5) - statsoft.msu.ru/ )

... Main page . ... Author . FemtoScan Online page two . ... The program works under Windows 95 and Windows NT, multiple document interface, wide set of mathematical and user functions. Designed for Nanoscope II, Nanoscope III & Femtoscan files, including f(z) files. ... build sections, histograms, measure height, angles and curves, use common and specific mathematical functions for image processing . use custom palettes, change color mapping, change scaling factor, save picture as bitmap . ...

Еще в разделе: (Показать все результаты (>89) - www.spm.genebee.msu.ru/ )

• Parameters of 3D Images
• AFM examination of TMV and virion RNA

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>185) - www.genebee.msu.ru/ )

• Databases
• Fasta 3.4
• GeneBee

... Antal , T.K., Volgusheva , A.A., Kukarskih , G.P., Krendeleva , T.E., Rubin, A.B. Relationships between H 2 photoproduction and different electron transport pathways in sulfur-deprived Chlamydomonas reinhardtii (2009) International Journal of Hydrogen Energy, 34, pp. ... Antal , T.K., Volgusheva , A.A., Kukarskikh , G.P., Krendeleva , T.E., Tusov , V.B., Rubin, A.B. Examination of chlorophyll fluorescence in sulfur-deprived cells of Chlamydomonas reinhardtii (2006) Biofizika ., 51 (2), pp. ...

Еще в разделе: (Показать все результаты (>2) - biophys.msu.ru/ )

• Spontaneous chemiluminescence of seedling roots

... Instructions are in README.TXT file inside the tarball. ... tar -xvf nhunt_x86.tar Query and database files should contain sequences in FASTA format ( wikipedia description ). ... Default name of the output file is 'nhunt.out'. ... Any parameter consists of key and value and is called as '-key value', where 'key' is one character and 'value' is any number of characters. -i Query file . ... No default value. -d Database file . ... No default value. -o Output file . ... Default value: 'nhunt.out' . ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• ConClus

О лаборатории . ... Лаборатория теоретической биофизики . ... This small program named TRAX is capable of solving systems of ordinary differential equations and plotting the solution on a phase plane as well as function of time. ... 1 комментарий " Phase plane explorer " . ... OPLS-AA patch for different types of molecules . ... All-atom automatic OPLS-AA topology generator . ... OPLS-AA? in All-atom automatic OPLS-AA topology? ... 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>43) - erg.biophys.msu.ru/ )

• cp2k ERG Research Group: Лаборатория теоретической биофизики
• toolset ERG Research Group: Лаборатория теоретической биофизики
• Gaussian Cube files loader ERG Research Group: Лаборатория теоретической

... SDPfox - the software package for the prediction of functional specificity groups and amino acid residues that determine the specificity using MPA. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...

Еще в разделе: (Показать все результаты (>5) - bioinf.fbb.msu.ru/ )

Full-text editions of historical sources . on the history of Russia (in Russian) . on the Internet . ... Collection of electronic resources on history . from the library of historical sources . on our site . ... Library 'Museum of the Decembrists' - documents concerning the Decembrist insurrection of 1825. http://decemb.hobby.ru/ . ... Several sources on Russian history are on a site with documents on the history of Finland. http://www.pp.clinet.fi/~pkr01/historia/history.html . ...

Еще в разделе: (Показать все результаты (>9) - www.hist.msu.ru/ )

• Moscow State University. Faculty of History. Visiting Scholar's Program

... The scientific and investigating activities of the laboratory are spread in three main dimensions. ... Leading Research Associate Gibalov V.I. Assistant of professor Tkachenko S.N. Senior Research Associate Samoilovich V.G., Kozlov K.V., Popovich M.P. New Effective Enamel Coating of HF-ozonizers Electrodes . ... assistant of professor Antipenko E.E. Senior Research Associate Zosimov A.V. Ozone Including Oxidation Reactions . ... NON-TRADICIONAL METHODS OF CHEMICAL AND CATALYTIC REACTIONS PERFORMANCE...

Еще в разделе: (Показать все результаты (>26) - www.kge.msu.ru/ )

• Публикации
• CPU RightMark Screen Saver

... Lomonosov Moscow State Univ Research Center "Computer Science and Control" of RAS (FRC CSC RAS) Operations Research Society (RSORS) will organize the VIII Conference in Octo Operations Research. theoretical aspects and ersity (MSU), Federal and Russian Scientific ber 2016 in Moscow. ... Deadline for abstract submissions is March 31, 2016. ... Conference website: http://io.cs.msu.ru/ORM2016.html. ... Selected extended abstracts will be published in the Conference proceedings. ...

Еще в разделе: (Показать все результаты (>17) - io.cmc.msu.ru/ )

• http://io.cs.msu.ru/ORM2016/ORM2016-2nd_announ-ENG.pdf

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>4) - www.bio.msu.ru/ )

• The Second White Sea Molecular Zoology Summer School ? Биологический факультет

... The RELEC experiment was specially developed for study of relativistic electrons in near-Earth space together with TLEs in order to test possible connection between these two phenomena. ... Data from RELEC mission will be processed for testing TLE models, studying of TGF light curves and spectra, testing possible connection between electron precipitations and low-frequency electromagnetic waves. ... Energy range: 0.1 - 15 MeV (for electrons) . ...

118. IONS-Moscow

119. UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

120. http://num-anal.srcc.msu.su/meth_mat/prac_alg/arfil/symc1.txt