Mathematical modeling of biophysical processes in living cells and tissues . duration 6 months . ... 7(095) 939-26-12, Fax: +7(095)939-31-13, Email: romanov@yumr.phys.msu.ru . ... Interaction of femtosecond laser pulses with plasmas of modified targets . ... Theoretical investigations of polarization self-action and wave-interaction effects in nonlinear optics. ... Alexander V. Priezzhev, Associate Professor, Candidate of Sciences (physics and mathematics), Tel. ...

Еще в разделе: (Показать все результаты (>27) - foroff.phys.msu.ru/ )

• Faculty's Tuition Structure
• Postdoctoral training of foreign scientists at Physical Department

pic] Program of humanitarian aid from Russia Rectors' Union (RRU) to South-Ossetia's Tibilov State University The first batch of humanitarian aid from RRU to South-Ossetia's Tibilov State University was dispatched to Vladikavkaz by Ministry of Emergencies' charter plane at August 27. It included 1612 classical textbooks and manuals, and a modern computer training-room, comprised of 34 units of equipment. ... September 16, another charter plane has delivered the second batch of humanitarian aid. ...

Еще в разделе: (Показать все результаты (>37) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/396.doc

... Юрий (admin) Новости R , RTips , полезные советы , работа с данными No Comments . ... comment(data) . ... Юрий (admin) Новости R , анализ данных , визуализизация данных , геолокация , интернет-технологии , онлайн-сервисы , онлайн-тесты , психологический тест , тестирование онлайн No Comments . ... Загрузим данные . ... Юрий (admin) Новости R , анализ и визуализация данных , графики , статистика No Comments . ... Юрий (admin) Новости R , полезные советы , работа с данными No Comments . ...

Еще в разделе: (Показать все результаты (>19) - tukachev.flogiston.ru/ )

• Statistics One, Assignment One
• Statistics One, Lecture 3, example script
• Statistics 1, Assignment 2

... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin’s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>21) - lcl.srcc.msu.ru/ )

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>110) - eng.geogr.msu.ru/ )

• Interuniversity council for erosion and fluvial processes
• Faculty of geography Lomonosov Moscow State University
• THE MAKKAVEEV LABORATORY OF SOIL EROSION AND FLUVIAL PROCESSES

American Center ? March 2004 . ... 2 pm - EIC Lecture Education in the US . 5 pm - Film: . ... 5 pm - Presentation American and Russian Humor: Can it Cross Borders? ... International Women?s Day . ... 5 pm - Documentary Film: Women as Citizens . ... 6 pm - Lecture: American Women Poets , Carol Davis, Poet, Santa Monica College . ... 6 pm - Lecture: What is Justice? ... 6:30 pm - Lecture: Women Working in Television, . ... American Center, Moscow Tel: 777-65-30 amcenter@amc.ru www.amc.ru . ...

Еще в разделе: (Показать все результаты (>131) - www.prof.msu.ru/ )

• INTERNET RESOURCE LIST
• American Center Moscow
• American Center Moscow- November 2006

. Information by your request is not available. This is ejudge contest administration system, version 3.5.1+ (GIT 2eb5ef0), compiled 2016-03-20 11:30:56. This program is copyright 2000-2016 Alexander Chernov. This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation ; either version 2 of the License, or (at your option) any later version. Visual design and web-interface 2006-2016 Toto Lasvik .

Еще в разделе: (Показать все результаты (>8) - acm.msu.ru/ )

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>6) - npidb.belozersky.msu.ru/ )

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>27) - dynamo.geol.msu.ru/ )

• Professional experience of V.Zakharov

ARTICLE IN PRESS N IM B Beam Interactions with Materials & Atoms Nuclear Instruments and Methods in Physics Research B xxx (2005) xxx­xxx www.elsevier.com/locate/nimb Gas cluster ion beam infusion processing of semiconductors R. MacCrimmon *, J. Hautala, M. Gwinn, S. Sherman Epion Corporation, 37 Manning Road, Billerica, MA 01821, United States Available online Abstract The application of gas cluster ion beam (GCIB) infusion in advanced IC fabrication is described. ... B xxx (2005) xxx­xxx Fig. ...

Еще в разделе: (Показать все результаты (>103) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_energydistribution.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb237_455_1maclasterionSource.pdf
• http://danp.sinp.msu.ru/Articles_GSIB/nimb_GCIB_Ar_Smoothing_Swenson.pdf

... Host City . ... Aug 31, 10.00 Excursion to Dmitrov . Excursion to Dmitrov Visit the ancient Russian town of Dmitrov and shake hands with Yuri Dolgoruki, a medieval Russian prince, who incidentally happens to be also the founder of the city of Moscow. Dmitrov known as the Moscow's Nohern pearl is just 65 kilometers north of Moscow on the suburban road. ... Dmitrov finally entered the Moscow county in the 16th century, after a lengthy internal struggle among its princes. ...

Еще в разделе: (Показать все результаты (>19) - www.elch.chem.msu.ru/ )

... Дисциплины . ... On-line консультант . ... Главная Дисциплины Основы IT - менеджмента . Лектор и автор курса Козлов Д.Д. В курсе рассматриваются вопросы выстраивания экономически эффективной ИТ-инфраструктуры предприятия на основе сервисно-ориентированной модели ITSM. В рамках курса изучается библиотека IT Infrastructure Library и рассматриваются процессы управления информационно-коммуникационной инфраструктурой, предоставления и поддержки услуг. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>9) - erp.cmc.msu.ru/ )

... Do those millions of sites and services provide useful information, or are they just "information pollution"? ... Abstract This is a review of electrochemical information and services available on the internet, and some evaluation of their usefulness for professionals, students, and the general public. ... Two examples are the "Internetchemistry" site [26] and the "Electrochemical Science and Technology Information Resource (ESTIR)", which lists over 1,000 links to electrochemistry-related sites [7]...

Еще в разделе: (Показать все результаты (>69) - electr003.chem.msu.ru/ )

Space Weather . ... Space weather . ... Data . ... You should fill in "Workspace" by groups of data sets to create plots. ... Putting different kind of data into the same plot remember, that the first dropped data set chooses and determines the axis scale for all data. ... If you need both kind of scale in the same plot, create two different plots and unite them. The speed of this service depends on 3 components: data processing on server, data transmission and data plotting in your browser. ...

Еще в разделе: (Показать все результаты (>6) - swx.sinp.msu.ru/ )

NMW survey overview . Access image archive . ... The New Milky Way survey aims to detect bright (V<13.5) optical transients near the Galactic plane using an automated wide-field (8x6 deg.) system capable of surveying the whole Milky Way area visible from the observing site in one night. ... All images obtained during the transient search survey are available online (please use the image archive access form ). ... Images per field: . ... Images per night: . ... Milky Way imaging time: . ...

Еще в разделе: (Показать все результаты (>2) - scan.sai.msu.ru/ )

... On the Institute . ... Development of relational methods of studying time [Chief: V.V. Aristov, Dr. Sci. (physics and mathematics)] . ... Physics of relic radiation, fundamental interaction mediator, carrier of space and time [Chief: I.M. Dmitrievsky, PhD (technology), Ass. ... Algebraic structure of space-time, algebrodynamics of fields and particles [Chief: V.V. Kassandrov, PhD (physics and mathematics)] . ... Causal mechanics [Chief: S.M. Korotaev, Dr. Sci. (physics and mathematics)] . ...

Еще в разделе: (Показать все результаты (>11) - temporology.bio.msu.ru/ )

... Individual SELEX products, aptamers, are small molecules (40­100 nt) that have a unique three-dimensional structure, which provides for their specific and high-affinity binding to targets varying from low-molecular-weight ligands to proteins. ... Selection of aptamers binding with a target is the key step in SELEX, as aptamers account for only a small fraction of the initial library (one aptamer per 109 to 1013 molecules) [6]. ... Fourth, modification can increase the aptamer affinity for a target. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

... Process of Forming a Company . ... Инновационная . структура МГУ . ... деятельности . ... Finance for Start-Up . ... Identify what information, expertise, and skills set is required to start company development. Determine if your technology is at the appropriate stage of development and if this is the appropriate time to proceed with start-up company development. ... 2005 Управление инновационной политики . и организации инновационной деятельности . МГУ им. М.В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>34) - innovation.msu.ru/ )

• Process of Forming a Company - Discussion Question