Aleksanteri Institute Visiting Scholars Programme Aleksanteri Visiting Fellowships 2013 ­2014 THE FELLOWSHIP Is intended for scholars who hold a PhD degree in a field relevant to the Aleksanteri Institute 's research agenda and whose place of residence i s outside of Finland Is for a period of two to three months between August 2013 and June 2014 Involves a research stay at the Aleksanteri ... An electronic application form 2. ... The applications are evaluated by three experts. ...

Еще в разделе: (Показать все результаты (>87) - www.mgubs.ru/ )

• http://www.mgubs.ru/images/Image/Aleksanteri_Visiting_Fellowships_2011-2012.pdf

... Gpu | ... 10 , MULtI- GPU ABSoft Neat Video Adobe After Effects CC Autodesk Flame Premium Boris FX Continuum Complete Cinnafilm Dark Energy Plug-in CoreMelt complete eyeon Fusion GenArts Monsters Gt GenArts Sapphire roBUSKEY Neat Video open FX NewBlueFX Video Essentials NewBlue titler Pro Pixelan AnyFX re:Vision Effects red Giant Effects Suite red Giant Magic Bullet Looks the Foundry HIEro the Foundry NUKE and NUKEX Video Copilot Software Element 3D ... Q=Quadro Gpu, T=Tesla Gpu. ...

Еще в разделе: (Показать все результаты (>10) - ccoe.msu.ru/ )

• http://ccoe.msu.ru/sites/default/files/presentations/Moscow-Keynote-Hwu-10-22-2012.pdf

Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...

Еще в разделе: (Показать все результаты (>56) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization
• Faculty of Geology >> Geology at Moscow State University

... The Art of Computer Programming . Association for Computing Machinery (ACM) - Turing Award . ... California Institute of Technology . ... Computers: History and Development . Computer Musing . ... Digital Typography . ... History of Computing - IBM 650 . ... Don Knuth's Home Page . Knuth: Digital Typography . Donald Knuth wins Kyoto Prize . Literate Programming Library . ... Softpro Books - Art of Programming . ... Westinghouse Science Honors Institute . ...

Еще в разделе: (Показать все результаты (>288) - www.nature.web.ru/ )

• Theoretical Computer Science: взгляд математика
• Международный семинар "Optics in computing"

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... On October, 2014 February 2015 the students of the Faculty of Journalism, MSU were studying atљ Humboldt University of Berlin . ... Representatives of German party have repeatedly participated in educational programs organized by the Faculty of Journalism and the lecturers of the partner university are the regular guests of the house on the Mokhovaya street.љ ...

Еще в разделе: (Показать все результаты (>89) - www.journ.msu.ru/ )

• About MSU :: Department of Journalism, M. V. Lomonosov Moscow State University
• New Media and Communication Theory :: Department of Journalism, M. V. Lomonosov
• Sociology of Mass Communications :: Department of Journalism, M. V. Lomonosov

... Director of the Institute of World Culture . Member of Russian Academy of Sciences . ... Moscow State Lomonosov University (MGU); Institute of Slavic Studies of the Russian Academy of Sciences; Russian State Humanities University (RGGU); University of California, Los Angeles (UCLA), Department of Slavic Languages and Literatures and Indo-European Studies Program. ... Director of the Research Institute of World Culture of the Moscow Lomonosov State University (MGU), 1989-present. ...

Еще в разделе: (Показать все результаты (>15) - imk.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... Economic and Social Geography of Russia . ... The Natural Risk Assessment Laboratory . ... World Data Center for Geography . ... Russia s natural, economic and socio-demographic global potential . ... Supply and consumption of fresh water . Total supply and consumption of fresh water . Supply and consumption of fresh water per capita . ... Water pollution . ... Water consumption per capita. ... Sustainability of development of the environment in Russia . ... Development of Russia s industry . ...

Еще в разделе: (Показать все результаты (>43) - eng.geogr.msu.ru/ )

• Faculty of geography Lomonosov Moscow State University

NATO Publishing Unit P.O. Box 17 3300 AA Dordrecht A U T H O R 'S D A T A B A S E E N T R Y S H E E T (to be submitted together with the scientific paper ) REFERENCE: ARW978587 TITLE OF THE NATO MEETING/ NATO ASI SERIES VOLUME : Use of Humic Substances to Remediate Polluted Environments: from Theory to Practice NAME OF THE DIRECTOR: Dr. Norbert ... The total space available for keywords and abstract of your paper is 900 characters (approx. 100 words). ...

Еще в разделе: (Показать все результаты (>91) - mgumus.chem.msu.ru/ )

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>43) - new.math.msu.su/ )

• Vestnik Moskovskogo Universiteta. Matematika, Mekhanika

... A comparative study of thermodynamic for both natural and artificial RNA/DNA ­ protein complexes would establish bases for a specificity of complex formation. In particular, we have shown that aptamers could be used for a direct measuring of thrombin enzymatic activity in a solution. D 2002 Published by Elsevier Science B.V. Keywords: RNA/DNA ­ protein interactions; Ribosome; SELEX; RNA/DNA aptamers; Thrombin; Enzymatic activity 1. ... The aptamer binds to the protein with Kd = 0.5 nM. ...

Еще в разделе: (Показать все результаты (>5) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2002_1.pdf
• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf

... Funds/Grants Page at Moscow State University [In Russian] . ... Physics Journals . ... Information for authors . ... Laser Physics (MAIK NAUKA) . ... Quantum Electronics . ... Quantum Optics, Quantum Information, and Quantum Computing . ... European Research Network--The Physics of Quantum Information . ... Quantum Information Processing National Project (Germany) . Quantum Imaging Lab, Boston University . ... Institute for Quantum Information (Caltech) . ... 2016 Quantum Information Laboratory. ...

Еще в разделе: (Показать все результаты (>73) - qilab.phys.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>17) - observ.pereplet.ru/ )

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1546) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

University Satellites and . Space Science Education . ... Aerospace and remote sensing education in the Geography schools of Moscow and Cambridge universities . ... The two well-known universities under comparison, namely the Lomonosov Moscow State University, and the University of Cambridge, UK have well established traditions of geographical remote sensing. ... Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>79) - cosmos.msu.ru/ )

• Space Scientific and Education project of Lomonosov Moscow State University

News of PARALLEL.RU par-news на mail.parallel.ru . ... Разработка грид-сервиса управления заданиями ГридННС Pilot на основе архитектурного стиля REST . http ://agora.guru.ru/parallel ------------- НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + Intel представляет секцию параллельное программирование конференции TechDays.ru. http ://www.techdays.ru/category/21.html + Georgia Institute of Technology создает Institute for Data and High Performance Computing ...

Еще в разделе: (Показать все результаты (>114) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #298 [23/11/2010]
• PARALLEL.RU - Новости, выпуск #311 [08/07/2011]
• PARALLEL.RU - Новости, выпуск #385 [20/05/2015]

The most up-to-date information related to atmos 3.0 are collected here due to constantly increasing interest to MASS/DIMM processing software... atmos 3.0 is still beta , so the latest version is 2.97.5 (there is also 2.98.x branch which absorbs new features) . ... M' line: . ... free seeing and its relative error . ... dimm seeing and its relative error (if dimm data are present, zeros otherwise) . ... dimm turbulence power and its relative error (if dimm data are present, zeros otherwise) . ...

Еще в разделе: (Показать все результаты (>24) - curl.sai.msu.ru/ )

• . The . MASS . Group .