Gamma-quanta from SNRs V.N.Zirakashvili Pushkov Institute of Terrestrial Magnetism, Ionosphere and Radiowave Propagation, Russian Academy of Sciences (IZMIRAN), 142190 Troitsk, Moscow Region, Russia Outline · Acceleration of particles at forward and reverse shocks in SNRs · Amplification of magnetic fields · Modeling of broad-band emission · Radioactivity and electron acceleration Diffusive Shock ... 2010) . ... Cosmic ray positrons can be accelerated at reverse shocks of SNRs. ...

Еще в разделе: (Показать все результаты (>2) - tunka.sinp.msu.ru/ )

... David Kirk/NVIDIA and Wen-mei W. Hwu , 2007-2012 ECE408/CS483, University of Illinois , Urbana-Champaign 14 CUDA Device Memory Management API functions · cudaMalloc() ­ Allocates object in the device global memory ­ Two parameters · Address of a pointer to the allocated object · Size of of allocated object in terms of bytes ( Device ) Grid Block (0, 0) Block (0, 1) Registers Registers Registers Registers · cudaFree() ­ Frees object from ...

Еще в разделе: (Показать все результаты (>3) - ccoe.msu.ru/ )

... Using Ar clusters accelerated by 30 kV, with a dose of ° ° 6 · 1014 e cmю2, we have effectively removed an asperity that was 3500 A wide and 350 A high. Subsequent processing ° ° with 5 kV acceleration reduced the surface roughness from an Ra value of 13.2 A to 4.8 A. This demonstrates the effectiveness of GCIB for reducing sub-micron roughness to atom level smoothness. с 2005 Elsevier B.V. All rights reserved. ... Technique and results Fig. 1 shows schematically the GCIB beamline [2]. ... Fig. ...

Еще в разделе: (Показать все результаты (>41) - danp.sinp.msu.ru/ )

... В.Е.Юрасова, Современные теории катодного распыления и микрорельеф распыляемой поверхности металла, ЖТФ, 1958, 28, ?9, 1966-1970. ... V.I.Shulga, I.G.Bunin, V.E.Yurasova, V.V.Andreev, B.M.Mamaev, Influence of surface semichannels on ion scattering by crystals, Phys. Lett., ... Рентгеновские, синхротронные и нейтронные исследования, 2000, ? ... Особенности распыления сплавов Ni-Pd с разным содержанием компонент, Поверхность - рентгеновские, синхротронные и нейтронные исследования, 2006, ?7, 13- 17. ...

Еще в разделе: (Показать все результаты (>3) - physelec.phys.msu.ru/ )

• http://physelec.phys.msu.ru/staff/zykovapubl.doc

Генетическая кристаллохимия . ... Исследуются причинно-следственные связи структурных преобразований в гомологических и морфотропных рядах минералов. ... На примере минеральных групп фосфатов, боратов, силикатов, ванадилфосфатов и борофосфатов прослеживаются пути формирования и преобразования кристаллических структур минералов в породах различных геохимических типов . ... Типоморфизм минералов. ... Якубович О.В., Урусов В.С. Генетическая кристаллохимия фосфатов гранитных пегматитов // Вестник МГУ. ...

Еще в разделе: (Показать все результаты (>21) - cryst.geol.msu.ru/ )

... Contact information . ... 119991, Moscow, GSP-1, Leninskiye Gory, MSU, 2nd Educational Building, CMC Faculty . ... Our goal is to provide researchers from many branches of science, education and industry with innovative tools and methods for solving applied problems using the latest information technologies, modern methods of computation modeling and scientific visualization. ... The uncertainty can be used in further uncertainty estimation of a computational model that uses FetchClimate. ...

Еще в разделе: (Показать все результаты (>89) - en.cs.msu.ru/ )

• Research Laboratory of Computational Modeling Tools
• Department of Systems Analysis | CMC MSU

... Geography of World Economy . ... Field stations . ... Type of field courses . ... Khibiny station . ... Arkhangelsk station . ... The Arkhangelsk (Ustiayansk) research and training field environmental station is located in Ustiayanskyi district of the Arkhangelsk Region in the interfluve area of Vaga and Northern Dvina rivers. ... Emelianova L.G., Goriayinova I.N., Miaylo E.G. The Life of Taiga (Ecological Excursions in Ustiayanskyi district of the Arkhangelsk Region) M., Arkhangelsk. 1999. 162 pp. ...

Еще в разделе: (Показать все результаты (>27) - eng.geogr.msu.ru/ )

• Khibiny teaching and research station
• Geoecology of the Northern Territories

О КАФЕДРЕ . ... Трухин В. И. Жиляева В.А. Жиляева А. И. Петрунин Г. И. Список публикаций ћСписок статей . ... Бобров А. В., Жиляева А. И. Минеральные ассоциации включений в гранатах из кимберлитовых трубок Мир и Сытыканская (Якутия) //Вестник НСО. ... A. Zhilyaeva, L. Leonyuk, G.-J. Babonas, G. Bocelli, S. Demishev, N. Leonyuk, V. Maltsev, A. Reza. ... Трухин В.И., Жиляева В.А., Жиляева А.И. Вязкая намагниченность (VRM) базальтов тройственного сочленения Буве (Южная Атлантика) // Физика Земли. ...

Еще в разделе: (Показать все результаты (>3) - geo.phys.msu.ru/ )

... Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #263 [14/04/2009] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru / news / + NVIDIA предоставляет пользователям OpenCL Driver. http ://www.nvidia.com/object/io_1240224603372.html + Psychsoftpc выпускает Psychlone Tesla Personal Supercomputer. http ://www.psychsoftpc.com/psychlone_tesla.htm + NSF финансирует участие 14 университетов в программе IBM/Google Cloud Computing University Initiative. http ://www.nsf.gov/ news...

Еще в разделе: (Показать все результаты (>16) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #261 [18/03/2009]
• PARALLEL.RU - Новости, выпуск #266 [27/05/2009]

... Microstructure deeply influences the properties and thus the functionality of a material. In an X-ray diffraction pattern, the microstructure information is usually extracted from the breadth and shape of line profiles. ... Доклад ?Structure/microstructure and their interplay in nanomaterials and layered systems? оказался очень полезным и интересным для ученых, работающих в области неорганического синтеза и физико-химических методов исследования. ...

Еще в разделе: (Показать все результаты (>13) - nano.msu.ru/ )

... October, 2005 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! ... You will not only learn Russian for your professional career, but also learn a lot about Russia and its people that will allow you to communicate with your Russian clients more efficiently. www.rlcentre.com . ... Europalia International welcomes the biggest country in the world to a new edition of its multidisciplinary and edifying festival. ...

Еще в разделе: (Показать все результаты (>3) - www.rlcentre.com/ )

On this page you will find a list of images of SN 1998bp which was found in NGC 6495 . ... M1 supernova search has a 1998bp page New 1/8/99 . M.Armstrong discovery image 4/29/98 . ... Spectroscopy has performed by ESO group and Harvard group: they report that SN 1998bp is of type Ia around the maximum, but peculiar. ... 3127 (A.Ap.Suppl, 113, 151 (1995)) ESO group 4500 These three indicate that NGC 6495 is not so near as Virgo cluster; it looks like about three or four times further than Virgo. ...

Еще в разделе: (Показать все результаты (>21) - www.rochesterastronomy.org/ )

• Supernova 2002bl in UGC 5499

Series on Stability, Vibration and Control of Systems, Series A - Vol. ... MULTIPARAMETER STABILITY THEORY WITH MECHANICAL APPLICATIONS . ... This book deals with fundamental problems, concepts, and methods of multiparameter stability theory with applications in mechanics. ... Introduction to Stability Theory . ... Read Full Review . ... Since Bolotin's pioneering book on nonconservation problems on the theory of elastic stability, not many books appeared at such a high level, such as this one. ...

Еще в разделе: (Показать все результаты (>19) - mailybaev.imec.msu.ru/ )

• Book review by Professor Wolfhard Kliem

... Study of the Russian " Silver Age " neology . ... Dictionaries of neologisms constitute an important part of lexicography. ... The peculiarity of our project is the full scope of text (at least published) considered and uniformity of description: dictionary entries of all the authors’ neologisms have the same format (suggested for Khlebnikov’s neology). ... Khlebnikov's neology (N. N. Pertsova). In 1995 "The Dictionary of Khlebnikov's Neologisms" was published. ...

Еще в разделе: (Показать все результаты (>11) - lcl.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>2) - mouse.genebee.msu.ru/ )

• ConClus

... Real environments where objects are settled down are non-uniform and they are the source of many physical problems of acoustical imaging. ... Two groups of methods of image reconstruction in non-uniform environments are considered, and the basic attention is given to nonlinear phase methods as unlike methods of the first group, wave front inversion by matched filtering processing, they do not require detailed knowledge of parameters of the non-uniform medium. ... Acoustics of non-uniform mediums. ...

Еще в разделе: (Показать все результаты (>18) - www.msm.biophys.msu.ru/ )

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>13) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Proceedings Download Page

Home . Data . ... Meteor-M тДЦ1 . ... Meteor-M тДЦ2 . ... Solar energetic particles . ... Solar flare database (RU) . ... Space Monitoring Data Center of SINP MSU (SMDC) collects the data of space experiments as well as scientific and applied models for studying the geomagnetic and radiation conditions in the near-EarthтАЩs space environment. ... Latest data from featured spacecrafts . Meteor-M #1 is alive! ... Space weather now . ... NOAA N3KL Solar Activity Monitor . ... Developed in 2007. ...

Еще в разделе: (Показать все результаты (>7) - smdc.sinp.msu.ru/ )

... Publications . ... Number of publications 0 . ... Borisov A. V. , Kazakov A. O. , Kuznetsov S. P. Nonlinear dynamics of the rattleback: a nonholonomic model . ... A number of strange attractors are considered, for which phase portraits, Lyapunov exponents, and Fourier spectra are presented. ... Borisov A. V., Kazakov A. O., Kuznetsov S. P., Nonlinear dynamics of the rattleback: a nonholonomic model , Physics-Uspekhi, 2014, vol. 184, no. 5, pp. ... Institute of Computer Science Izhevsk, 2005 - 2016 ....

Еще в разделе: (Показать все результаты (>64) - ics.org.ru/ )

... About Space Monitoring Laboratory, scientific directions, instruments, contacts . ... В XXI веке в оптической астрономии появился новый мощный инструмент исследования Вселенной - синоптические обзоры или синоптические телескопы. ... Но если иметь в виду астрофизический объект вам обязательно понадобится спектральный телескоп, чтобы понять его физическую природу или установить его подтип. ... В основном спектральные телескопы имеют диаметры до 2-3 метров (таких телескопов в мире более 50). ... МАСТЕР...

Еще в разделе: (Показать все результаты (>9) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists