... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>22) - erp.cmc.msu.ru/ )

... Egor V. Tikhonov Department of Chemistry Moscow State University Leninskie Gory Moscow, Russia,119992 Tel: (095) 939-2086 FAX: (095) 932-8846 e-mail: high_egor@mail.ru . ... Student, Diploma work 'Study of oxidation of PbTe surfaces' . ... Field of interest : surface science, solid state chemistry and physics, synchrotron radiation, semiconductors, crystal growth techniques. ... Тихонов Е.В. Определение лимитирующей стадии роста кристаллов PbSe методом 'пар-жидкость-кристалл'. ... Тихонов Е.В.. ...

Еще в разделе: (Показать все результаты (>40) - www.inorg.chem.msu.ru/ )

PRL 105, 010404 (2010) PHYSICAL REVIEW LET TE RS week ending 2 JULY 2010 Statistical Estimation of the Efficiency of Quantum State Tomography Protocols Yu. ... It is based on a priori estimation of the quality of an arbitrary protocol by means of universal asymptotic fidelity distribution and condition number, which takes minimal value for better protocol. ... The present approach allows to analyze arbitrary protocols of statistical reconstruction of quantum states. ... 1] M. Genovese, Phys. Rep. ...

Еще в разделе: (Показать все результаты (>81) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf
• http://qi.phys.msu.ru/kulik/Papers/PRA10301.pdf
• http://qi.phys.msu.ru/kulik/Papers/PRL01370.pdf

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

List of Publications Elena A. Kudryavtseva March 2007 1. Gerver, M. L. and Kudryavtseva, E. A. (1995): A theorem on precedence relations generated by completely positive kernels. ... Russian Math. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2001): Intersection index of curves on surfaces and applications to quadratic equations in free groups. ... Gonё calves, D.L., Kudryavtseva, E., and Zieschang, H. (2002): Ro ots of mappings on nonorientable surfaces and equations in free groups. ...

Еще в разделе: (Показать все результаты (>46) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/koudr/publ3eng.pdf

extra:model:main ]] . CompHEP . ... Please address any questions concerning models to their authors. Authors of a model keep all rights. Any CompHEP user may apply a model respecting conditions defined by the authors. ... Model ==== ** Model description ** * Name: modelname * Author: modelauthor * Short description: * Long description: see [[http://www.univ.com/author/auth|modelauthor]] * {{http://comphep.sinp.msu.ru/extra/model/auth.zip|auth.zip}}, 123KB * References: - ref 1 - ref 2 .. ...

Еще в разделе: (Показать все результаты (>90) - comphep.sinp.msu.ru/ )

• web_links [CompHEP]
• news [CompHEP]
• tutorials [CompHEP]

High-pressure melting relations of diamond-forming carbonatites : formation of syngenetic peridotitic and eclogitic minerals (experiments at 7.0 and 8.5 GPa ) . ... Diamond was successfully synthesized in multicomponent carbonate-silicate melts at 5–7 GPa and 1200–1500њC [3]. ... Ol is a liquidus phase in the system with (CaCO 3 ћMgCO 3 ); at T < 1700њ С , an association of Cpx + Ol + carbonate-silicate melt (L) is stable; at 1600њ С , Grt is added. ... Ol + Cpx ( Grt ) + carbonate. ... Litvin Yu.A ., ...

Еще в разделе: (Показать все результаты (>708) - geo.web.ru/ )

• Encom Advanced Realities - Все о Геологии (geo.web.ru)
• KRANTZ, THE OLDEST MINERAL DEALER IN GERMANY,

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>81) - www.kosmofizika.ru/ )

Literature . ... Computers and Statistical Data Analysis. ... In Russian. ... Basic notions and methods of applied statistical analysis and usage of leading Russian and American statistical software tools: STADIA, STATGRAPHICS. ... The second edition has much more detailed depiction of temporal series analysis methods, review of statistical packages for Windows and recommendations on their choosing. ... Kulaichev A.P. Data Analysis Methods And Tools for Windows . ... In English and In Russian. ...

Еще в разделе: (Показать все результаты (>2) - statsoft.msu.ru/ )

... Fast Facts about the Faculty of Journalism . ... Academic Departments . ... Partners . ... All partners . ... During the round table, NAMMI and Lomonosov Moscow State University were represented by Sergey Smirnov, associate professor of the Faculty of Journalism of Lomonosov Moscow State University. ... 1999-2014 Faculty of Journalism, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>42) - www.journ.msu.ru/ )

• Full-time programs :: Department of Journalism, M. V. Lomonosov Moscow State

The name of film studio "Eh-Film" should be understood as phonetical reverberation of two key letters in ElectroChemistry. ... Academician Frumkin arrives to his Dept in Moscow University (usually he had spent two days at the Dept, and other days were devoted to his Institute). Staff is waiting for Frumkin in his office, and disappear from the office when Frumkin approaches the Dept. ... Finally Frumkin proposes the student to continue his experimental work for two weeks. ...

Еще в разделе: (Показать все результаты (>60) - electr003.chem.msu.ru/ )

• Academician Aleksandr Naumovich Frumkin
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage
• Vladimir Sergeevich Bagotsky

pic] Order Form Herbarium Linnaeanum - The Linnaean Collection of the Herbarium of Moscow State University - CD-ROM To obtain a copy of the CD-ROM, print and complete this form, then send or fax it to this address: Anna Hutson, Department of Botany, The Natural History Museum, Cromwell Road, London, SW7 5BD, UNITED KINGDOM. ... Name (first name, initials, | ... Postal address: | Email address: | Number of copies of the Herbarium | Linnaeanum | ... VAT Registration Number GB 645 4245 38 ...

Еще в разделе: (Показать все результаты (>504) - herba.msu.ru/ )

• Instruction to authors
• Systema Naturae
• Flowers: Diversity, Development and Evolution

Call Title: Call for proposals for ERC Advanced Investigators Grant Call identifier: ERC -2010-AdG Date of publication1: 29 October 2009 Electronic proposal submission deadlines2 (single submission of full proposal ): 3 Panels: PE1 - PE10 (Physical Sciences Engineering), 24 February 2010, 17.00.00 (Brussels local time) Panels: LS1 ­ LS9 ... Proposals may be evaluated remotely. At the end of this evaluation of step 1, the panel will rank the proposals according to their marks. ...

Еще в разделе: (Показать все результаты (>42) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/ERC_guide_preparation.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf
• http://ideas.msu.ru/docs/EPSS_guide.pdf

... E-MAIL ADDRESS: D.Khmelev@newton.cam.ac.uk . A new statistical method in the analysis of literary style for disputed authorship resolution is considered here. ... Consider a sequence of letter of text as a Markov chain. ... Suppose we take the logarithm of each probability, change a sign, and divide it by the length of control text; then each of the numbers obtained is called the relative empirical entropy . Relative empirical entropy is more convenient for computing than actual probabilities. ...

Еще в разделе: (Показать все результаты (>56) - old.philol.msu.ru/ )

• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of
• Footnotes
• HumLang - How to subscribe our list

... NEW TECHNIQUES FOR COMPARING THE VOLUME FUNCTIONS OF HISTORICAL TEXTS V. V. Kalashnikov, S. T. Rachev, and A. T. Fomenko We propose new techniques for estimating the degree of dependence of historical texts, such as annals, chronicles, etc. We consider texts "parametrized by time." This means that the text can be divided into a union of disjoint fragments, each describing the events of one year (or one decade, etc.) ... As a rich text we use the Tale of Bygone Years. ...

Еще в разделе: (Показать все результаты (>91) - hbar.phys.msu.ru/ )

• Age Determinations by Radiocarbon Content: Checks with Samples of Known Age
• Critical remarks

Open Conference Systems . Conference Help . ... All Authors Title Abstract Index terms Full Text . ... Call for Papers (March 1, 2016 - June 1, 2016) . ... By Conference . ... It is incumbent on the authors to obtain appropriate approval to present their work to this international forum. 35-word Abstract : Your abstract should be a brief summary of your paper topic. If your paper is accepted, your 35-word abstract will be included in the Conference Program and the Technical Digest on CD-ROM . ...

Еще в разделе: (Показать все результаты (>17) - hea.phys.msu.su/ )

• Call for Papers

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>208) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 71
• SAI OCL Catalog Berkeley 72

... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>5) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

... education . ... Composite materials . Materials for solar and fuel cells . ... Registration deadline is 30 April 2012. ... New deadline is 15 May 2012 . ... Registration fee should be paid before 10 June 2012. ... For information please contact Mrs. Olga Bogomolova: obogomol@gmail.com and Dr. Alexander Chertovich: chertov@polly.phys.msu.ru . ...

Еще в разделе: (Показать все результаты (>31) - nano.msu.ru/ )

• Information on interfaculty and interdisciplinary seminars on advanced fields
• Registration for the International School ?Computer simulation of advanced
• Statute on the Methodical Commissions of the MSU Nanotechnology Education and

... Could toads choose left or right side of the maze in experiment notwithstanding the position of odorant? Methods 36.8 cm 24.8 cm Paper with smell of Garter snake Area of smell center Area without smell Paper without smell of Garter snake Methods Paper without smell of Garter snake center Area Area without without smell smell Paper without smell of Garter snake We used 15 juvenile ...

Еще в разделе: (Показать все результаты (>70) - vertebrata.bio.msu.ru/ )

• Student Reports at International Conferences
• Выступления студентов и аспирантов на конференциях
• Vladimir V. Shakhparonov