Magnetism Department MSU . ... Magnetism department . ... Students . Phd students . ... For 2 grad students . ... Grad. students . ...

Еще в разделе: (Показать все результаты (>27) - magn.phys.msu.ru/ )

• Information for PhD students
• Some materials
• Collaboration

... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin?s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>19) - lcl.srcc.msu.ru/ )

... Дисциплины . ... On-line консультант . ... Главная Дисциплины Основы IT - менеджмента . Лектор и автор курса Козлов Д.Д. В курсе рассматриваются вопросы выстраивания экономически эффективной ИТ-инфраструктуры предприятия на основе сервисно-ориентированной модели ITSM. В рамках курса изучается библиотека IT Infrastructure Library и рассматриваются процессы управления информационно-коммуникационной инфраструктурой, предоставления и поддержки услуг. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>5) - erp.cmc.msu.ru/ )

... Home News Program Committee Organizing Committee Program Plenaries Special Sessions Registration Abstracts Accommodation Important dates Contacts Poster Links Conference Venue Video . Conference Venue . Conference Opening ceremony will take place on Tuesday, June 17 at 13:00 in the MSU Library Building . ... On other conference days registration will be possible in the room 706 of the 2-nd Educational Building. ...

Еще в разделе: (Показать все результаты (>12) - pont2008.cmc.msu.ru/ )

• Timetable of plenary lectures Международная конференция Дифференциальные

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• Nhunt: program for nucleic acid sequence similarity search

... The department was founded in late sixties by Prof. D.Ya.Martynov, who for many years was also the director of Sternberg Astronomical Institute. At present time, the head of the department is Prof. A.M.Cherepashchuk, a pupil of D.Ya.Martynov and his successor as the director of SAI. Since Prof. Martynov, the scientific activity of the department was primarily related to binary stars. ... The department consists of 15 members most of which have Ph.D. in Astrophysics. ...

Еще в разделе: (Показать все результаты (>7) - uranus.sai.msu.ru/ )

• Linux on CLEVO 8750
• Eugene Trunkovsky

... Почему передовые технологии программирования представляют особый особый интерес для "суперпрограммирования". Generative Programming - передовая технологии программирования, позволяющая совмещать небольшие накладные расходы на разработку программ и высокую производительность получаемого при этом программного кода. ... Generative programming объединяет в себе аспекты и подходы метапрограммирования, Generic programming, объектно-ориентированного программирования и Domain Engineering. ...

Еще в разделе: (Показать все результаты (>24) - new.math.msu.su/ )

Institute of Theoretical Geophysics . ... Consortium for Electromagnetic Modeling and Inversion (University of Utah) . SJ Geophysics Ltd . INFOMINE / Geomine - Geological Exploration and Technology (Links collection) . ... Zonge Engineering: Geophysical Modeling . CEMI software developed at the Center for Electromagnetic Modeling and Inversion (University of Utah). ... AGI Res3Dinv - 3D Resistivity Inversion Software . RINVERT - Resistivity Models and Modeling (or Modelling) Software . ...

Еще в разделе: (Показать все результаты (>34) - geophys.geol.msu.ru/ )

... Anti thrombin DNA aptamers were immobilized on silica microspheres, placed inside microwells on the distal tip on an imaging optical fiber, coupled to a modified epifluorescence microscope through its proximal tip. ... It should be mentioned that since thrombin is not a DNA binding protein, the possibility to elicit thrombinґaptamer complexes clearly demonstrates the power of SELEX technology. ... Specificity of aptamer coated beads for F thrombin binding was assessed with bovine serum albumin. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.su/pdfs/MolBio6_00KopylovLO.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

Programme of the International Congress Globalistics-2015 : Global Governance and Diplomacy in the Unstable World dedicated to the 70th anniversary of the UN and the Year of RUSSIA's Presidency ... 26th OCTOBER 09:3011:00 Registration of the participants of the International Scientific Congress Globalistics-2015 Venue : Intellectual Centre - Fundamental Library of Moscow State University, the 1st floor hall ... P-6 Address: Leninskie Gory, 1, b.51 (Metro "Universitet"). ...

Еще в разделе: (Показать все результаты (>1551) - fgp.msu.ru/ )

• Search Results пєп?п? п?п?пе п?п?. п?.п?. п?пЎп?пЎпҐпЎя?пЎп?п°

... Клуб выпускников / Доска объявлений . клуб выпускников члены клуба вступить в клуб наши партнеры . Поиск работы и вакансии . ... Для участия в разработке информационных систем для гражданской авиации (Linux, C++, Oracle) с возможностью проявить себя требуются программисты C++. ... приветствуется знакомство с Unix/Linux, SQL, любой уровень знания английского . ... премии по результатам работы . место работы - рядом с м. Динамо . ... URL: http://http://www.sirena2000.ru/sirena/about.html . ...

112. NEW MSU Graduates Club notice board