. General Information . News . Organizing Committee . Program . Registration . Registered participants . Symposium expenses . Accommodation and meal . Important deadlines . Presentation information . Abstract submission . Cultural Program . Travel information . Contact information . 14 European Symposium on . Gas Phase Electron Diffraction . 24-28 June 2011 . M. V. Lomonosov Moscow State University . 1 February 2011 . deadline for Registration . 20 April 2011 . deadline for Abstract submission .

Еще в разделе: (Показать все результаты (>15) - ged.chem.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Schedule : Nonlinearity of Media and Structures, Nonlinear Testing . ... Guyer R. (invited) . ... Esipov I. B. Nonlinear Sound Wave Propagation in 2-D Hysteretic Medium . ... Berndt T. P. Simultaneous Probing of the Nonlinear Effect of a Plane Unbonded Interface on Incident Longitudinal and Shear Acoustic Waves as a Function of Amplitude and Pressure . ... R. E. (invited) . ... Korobov A. I. Influence of Internal Structure of Polycrystalline Copper on Its Nonlinear Elastic and Acoustic Properties . ...

Еще в разделе: (Показать все результаты (>142) - acs366.phys.msu.su/ )

• Abstract
• Nonlinearity of Media and Structures, Nonlinear Testing
• Abstract (Invited)

... Geography of World Economy . ... Physical Geography and Landscape Science . ... About Faculty . ... Field stations . Faculty branches . ... Type of field courses . ... Among them there are: 2 Full Member and 4 Corresponding Members of Russian Academy of Sciences, distinguished scientists, laureates of State and Government Prizes of USSR and Russia in the field of education, science and technology, laureates of the Lomonosov and Anuchin Prizes and many more. ... Geografia [Moscow University Herald. ...

Еще в разделе: (Показать все результаты (>32) - eng.geogr.msu.ru/ )

... Ярмарка вакансий и стажировок для студентов и выпускников вузов . ... Вакансии . ... Mobile Communications Division . ... Mobile Handset (Product: Samsung Mobile Phone) . ... Designing, development, and porting of creative Mobile platform User Interface applications using GTK, Tiny-X and OpenGL ES compliant 2D / 3D Library . ... Development of GTK based applications . ... 1) Conceptual knowledge of UI frameworks, understanding of design patterns such as model-view-controller. ...

Еще в разделе: (Показать все результаты (>58) - www.physcareer.ru/ )

• Mobile Handset Multimedia and User Interface Framework Developer / Вакансии /

... The software models the dynamics of RNA secondary structure by the means of kinetic analysis of folding transitions of a growing RNA molecule. The result of the modeling is a kinetic ensemble, i.e. a collection of RNA structures that are endowed with probabilities, which depend on time. ... 19, Moscow, 127994, Russia. ... Danilova, L.V., Pervouchine, D.D., Favorov, A.V., Mironov, A.A. (2006) RNAKinetics: a web server that models secondary structure kinetics of an elongating RNA. ...

Еще в разделе: (Показать все результаты (>126) - bioinf.fbb.msu.ru/ )

... Las clases inician el 01 de Septiembre . ExАmenes Ordinarios Finales: del 01 al 25 de Diciembre . ... Los exАmenes (parciales) no son calificados cuantitativamente. ... El alojamiento en los dormitorios para estudiantes varМa desde $165.00 Dls. mensuales (dependiendo de las condiciones de equipamiento de la vivienda). ... Es importante aclarar que no existe ningЗn tipo de beca para estudiantes internacionales. ... 203 000 . ... Para mayor informaciСn, por favor no dude en contactarnos. ...

Еще в разделе: (Показать все результаты (>17) - foroff.phys.msu.ru/ )

• Глубокоуважаемые коллеги

... Магистерское образование . ... Enterprise Information Infrastructure . This course is focused on enterprise infrastructure and integration technology. Course presents different approaches to enterprise architecture and modern solutions of information infrastructure problems. Course?s topics cover strategies that help large enterprises to increase the agility of their IT systems. ... Enterprise portal technology, including collaboration and knowledge management . ... FI- Master data . ...

Еще в разделе: (Показать все результаты (>12) - hcs.cmc.msu.ru/ )

• Master program "Open Information Systems" | Магистерское и послевузовское

Kinetics of redox reactions of Pu(V) in solutions containing different fractions of humic substances O.A. Blinova*, A.P. Novikov, I.V. Perminova+, R.G. Haire *A.N.Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow , Russia , Vernadsky Institute of Geochemistry and Analytical Chemistry, Moscow , Russia , + Lomonosov Moscow State Univercity, Moscow , Russia , Oak Ridge National Laboratory Humic ...

Еще в разделе: (Показать все результаты (>104) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-grigoryev-transhumus.pdf
• http://www.mgumus.chem.msu.ru/publication/2009/2009-badun-tritium.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-chernysheva-radiochemical.pdf

About SPAW Editor . ... As of final version 1.0 of the control you'll need to rename the file spaw_control.default.config.php in config sub-directory to spaw_control.config.php when installing control for the first time. ... All of the SPAW Editor configuration options are located in the config/spaw_control.config.php file. ... This file will be included in img_library.php (Image library dialog script). $request_uri variable will be set to the URL of the page where SPAW Editor instance resides. ...

Еще в разделе: (Показать все результаты (>3) - textbook.sinp.msu.ru/ )

... CUBLAS и CUFFT - прикладные библиотеки, использующие CUDA для умножения матриц и преобразования Фурье. CUDA Data-Parallel Primitives Library - библиотека некоторых распространенных операций с данными, реализованных при помощи CUDA. ... ACML-GPU - процедуры математической библиотеки AMD ACML, реализованные на графическом процессоре. ...

Еще в разделе: (Показать все результаты (>3) - gpu.parallel.ru/ )

... Клуб выпускников / Доска объявлений . клуб выпускников члены клуба вступить в клуб наши партнеры . Поиск работы и вакансии . ... Для участия в разработке информационных систем для гражданской авиации (Linux, C++, Oracle) с возможностью проявить себя требуются программисты C++. ... приветствуется знакомство с Unix/Linux, SQL, любой уровень знания английского . ... премии по результатам работы . место работы - рядом с м. Динамо . ... URL: http://http://www.sirena2000.ru/sirena/about.html . ...

113. http://science.chem.msu.ru/index.php?view=article&catid=34%3Anews&id=144%3A2013-10-24-11-52-14&format=pdf&option=com_content&Itemid=57

114. Page4

115. http://www.fbm.msu.ru/upload/news/2012/12-05/progr.doc

116. http://fpga.parallel.ru/papers/gudkov.pdf

117. Institute Laboratory-Chairs

118. NEW MSU Graduates Club notice board