Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>254) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Кайя Кальпа: продление жизни и бессмертие
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

LangueDOC . ... Archives . ... Movie . ... Team . ... RUSSIAN . ... Khinalug . ... During the 2007 field trip to Khinalug, we took video records of our work. We are now pleased to offer you a 20 min movie telling about documenting an endangered language. ... The film is available in Russian with Engllish subtitles. ... юleksandr Kibrik . ... Danil Svidersky . ... with A. Arkhipov, M. Daniel, A. Kibrik . Text read by Aleksandr Kibrik . Khinalug dwellers . ... Aleksandr Kibrik . ...

Еще в разделе: (Показать все результаты (>330) - www.philol.msu.ru/ )

• Department for Discourse and Communication Studies
• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/ongoing_projects.html
• Department for Discourse and Communication Studies - Events

... Veselovsky, V.A., Djanumov D.A. The use of biophysical methods in the study of adaptive reactions of plants, in connection with the problem of resistance. ... Kulaeva, O.N., Mikulovich T.P., Veselova, T.V., Veselovsky, V.A., Kukina, I.M., Klyueva N.Yu. ... Veselovsky, V.A., Veselova T.V . ... Nauka, Moscow (in Russian).1990. 200 p. Veselova T.V., Veselovsky V.A., Chernavsky D.S. Stress of Plant: A Biophysical Approach. ... Veselova T.V., Veselovsky V.A. Photosynthesis and stress of plant cells. ...

Еще в разделе: (Показать все результаты (>4) - biophys.msu.ru/ )

... Inside the computer's microprocessor chip, a clock distribution system delivers the timing signals from the crystal oscillator to the various circuits, just as sound in air delivers the beat of a drum to soldiers to set their marching pace. ... Beat the Clock . ... Now researchers are designing asynchronous systems that can process data without the need for a governing clock. ... Without a clock to govern its actions, an asynchronous system must rely on local coordination circuits instead. ...

Еще в разделе: (Показать все результаты (>354) - chronos.msu.ru/ )

• Lev Kupershmidt
• Rosolino Buccheri. Time and the dichotomy subjective/objective. An
• Biology Direct | Full text | Erwin Schroedinger, Francis Crick and epigenetic

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>80) - srcc.msu.ru/ )

• Kazakevich, Olga. An obstinate community: a story of the relocation of the
• Laboratory of Systems for Automated Image Processing
• D.Moss, D.Sokoloff, R.Beck, Ram pressure effects in the galactic plane and

... It is more convenient to study the process of perfect flora revealing on the objects with clear natural borders, such as islands and lakes. ... We also compared our floristic lists for the two islands of the Chupa bay with analogous lists, got in the beginning of August 2001 (White sea expeditions…, 2001; Abramova et al., 2003) to reveal the changes in islands flora during these five years. ... Different species were usually overlooked on the close islands with similar flora. ... Chupa bay islands ....

Еще в разделе: (Показать все результаты (>172) - herba.msu.ru/ )

• Scheme of location of investigated mainland lakes of Gavrilovskij archipelago
• The investigation of zooplankton and entomofauna.
• Systema Naturae

pic] The Ministry of Education of the Russian Federation The Scientific and Methodological Council on Foreign Language Teaching The (Russian) National Association of Applied Linguistics (NAAL) The Faculty of Foreign Languages and Area studies of Lomonosov Moscow State University DECent - The Distance Education Centre Dear colleagues, You are invited to participate in the 2nd International Scientific and Methodological ... Teaching and learning a foreign language at a distance. ...

Еще в разделе: (Показать все результаты (>5) - dist.ffl.msu.ru/ )

• Факультет иностранных языков МГУ. Центр дистанционного обучения.

... A p P EC Astropar ticle Physics for Europe · Cosmic rays: A large array for the detection of charged cosmic rays ( Auger North) · Gamma rays: A large array of Cherenkov Telescopes for detection of cosmic high energy gamma-rays ( CTA ) · High energy neutrinos: A cubic kilometre-scale neutrino telescope in the Mediterranean (KM3NeT) · Dark matter search: Ton-scale detectors ... A p P EC Astropar ticle Physics for Europe · Cosmic rays: ­ ­ ­ ­ ­ AMS detector launched. ...

Еще в разделе: (Показать все результаты (>5) - tunka.sinp.msu.ru/ )

Thunderstorms and Elementary Particle Acceleration . ... Conference . The first announcement . ... The Thunderstorms and Elementary Particle Acceleration (TEPA-2012) conference is the second one devoted to the studies of the extreme atmospheric effects connected with amplification of electric fields in the lower atmosphere. ... TEPA-2012 conference will be held from July 9 till July 11, 2012, just after the 23rd European Cosmic Ray Symposium also organized by MSU ( http://ecrs2012.sinp.msu.ru ) . ...

Еще в разделе: (Показать все результаты (>2) - tepa2012.sinp.msu.ru/ )

... Ummidia gandjinoi (Andreeva, 1968) Figs 16. ... Color in alcohol: carapace, palps and legs dorsally hazelnut- brown ; legs along medial line and carapace along thoracic fovea and grooves with slightly paler pattern; eye tubercle dark brown , with blackish- brown spots surrounding AME and all lateral eyes; chelicerae uniformly reddish brown ; most (central) part of sternum, coxae IIV and legs IIIIV ventrally deep brownish yellow; sternal edges, labium, maxillae, palps and legs ... III. ...

Еще в разделе: (Показать все результаты (>1388) - zmmu.msu.ru/ )

• Global fossil bat records - abstract
• Russian Journal of Theriology

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt

ВМиК-Online! ... Студенты . ... Выпускники . Работа . ... Компания HP создает новые возможности для того, чтобы технологии приносили максимальную пользу людям, компаниям, государственным структурам и обществу в целом. ... Бизнес HP в России уже 6 лет подряд показывает результаты лучше рынка ИТ в целом. ... Вакансии компании Hewlett-Packard: . ... Телефон компании HP: +7 (495) 797-35-00. ... МГУ . ... Рейтинг компаний составляется на основе данных Клуба выпускников МГУ . ... 2001 2012 ВМиК Online! ...

Еще в разделе: (Показать все результаты (>6) - www.cmc-online.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>218) - observ.pereplet.ru/ )

... Публикации . ... С.В. Балахонов, Д.С. Лучинкин, М.В. Ефремова, Б.Р. Чурагулов, Ю.Д. Третьяков . ... Hydrothermal synthesis of a novel phase of vanadia-based nanowhiskers" . ... Ю.В. Коленько, А.А. Бурухин, Б.Р. Чурагулов, Н.Н. Олейников . ... Мескин П.Е., Баранчиков А.Е., Иванов В.К., Кистерев Э.В., Бурухин А.А., Чурагулов Б.Р., Олейников Н.Н., Комарнени Ш., Третьяков Ю.Д. "Синтез наноразмерных порошков Co3O4 в гидротермальных условиях с одновременным ультразвуковым воздействием" . ...

Еще в разделе: (Показать все результаты (>24) - www.inorg.chem.msu.ru/ )

• Group of Hydrothermal Synthesis :: Articles

... Departments . ... Head of the department: Moiseev Evgeny, Academician of RAS, Professor, Dr. Sc., Dean of the Faculty CMC MSU Contact information . ... Main topics are: boundary value and spectral problems for PDEs of elliptic and mixed type, spectral analysis, boundary control problems for oscillating processes, linear integral equations, completeness and basis properties of functional systems. ... Functional Analysis by Prof. Moiseev, 64 hours, 5th semester. ... Functional Analysis by Assoc. ...

Еще в разделе: (Показать все результаты (>115) - en.cs.msu.ru/ )

• Department of Functional Analysis and its Applications
• Open Laboratory of Information Technologies | CMC MSU
• Laboratory of Mathematical Physics | CMC MSU

The VLT Survey Telescope: a year after its coming into operation Massimo Capaccioli Department of Physics, University of Naples Federico II National Institute of Astrophysics - VST center at Naples The VLT Survey Telescope (VST) is a 2.6 m wide field optical telescope located at the Cerro Paranal Observatory of ESO in the Chilean Andes. ... The wide field is sampled by OmegaCam, a camera with a mosaic of 32 CCD for a total of 256 Mpixels, provided by the homonymous consortium. ...

Еще в разделе: (Показать все результаты (>15) - master.sai.msu.ru/ )

• Ya.B. Zeldovich All-Moscow Seminar of Astrophysicists

European Research Council IDEAS Coordination and Support Action (CSA) Call identifier: ERC -2009-SUPPORT Guide for Applicants Version: 16 July 2008 The Guide is published by the ERC -DIS on http:// erc .europa.eu It can also be downloaded from the CORDIS page on http://cordis.europa.eu European Commission FP7 Specific Programme IDEAS ... Consequently, the ERC needs to be rigorous in evaluating the very best science and researchers and in selecting innovative and "high risk/high gain" projects. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/Cooperation_partners.pdf
• http://ideas.msu.ru/docs/ERC_rules.pdf
• http://ideas.msu.ru/docs/Guide_SyG_2012.pdf

The typochemical features of pyroxenes from Paleozoic picrite dikes within Spitsbergen Archipelago . ... Discerned are three generations of the mineral: phenocrysts, groundmass microlites and xenocrysts. ... Type 1 . ... Al 2 O 3 and FeOt in most part of the grains decrease toward the second zone then increasing toward the rim (exception is one grain from dike of type 1 showing subsequent core-to-rim increase in aluminia). ... Average composition of pyroxenes for the zones of dikes of the both types . ...

Еще в разделе: (Показать все результаты (>360) - geo.web.ru/ )

• KRANTZ, THE OLDEST MINERAL DEALER IN GERMANY,
• Авторский сайт Владимира Мальцева - литература
• Trusov Sergey's homepage The influence of boundary layer effects on the melt

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...