... Пользователи -General- Common Current University Society Study Diaspora FAQ Real Estate -Technical- Development Hard&Soft Network Mobile -Market- Market Services Job -Hobby- Behemoth Health Love&Sex Еда Media Games Auto&Moto Sport Hobby Flood Zone -Servant- Alternative Forums Forum -Garbage- Revolution Garbage Private . ... Re: Аниме новинки [ re: Kai ] . ... Re: Аниме новинки [ re: gizm0 ] . ... Re: Аниме новинки [ re: bmv ] . ... Re: Аниме новинки [ re: Rad ] . ... Re: Аниме новинки [ re: blind ] ...

Еще в разделе: (Показать все результаты (>4655) - www.snto-msu.net/ )

• По мотивам С/К Богачева: синхронизация потоков. - Public forum of MSU united
• Вакансии в HSBC - Public forum of MSU united student networks
• Политический юмор - Public forum of MSU united student networks

... Anatoliy A. Polikarpov . Among various kinds of typological development in language system there are two significant interrelated cases, namely, cases of language system drift to more analytic or, on the countrary, to more synthetic structure. ... These two factors contradict each other in the process of building a new system on the stage of speech adaptation, but they coincide in the "direction" of their action on the stage of language adaptation. ... BREITER M.A., POLIKARPOV A.A. [1997]. ...

Еще в разделе: (Показать все результаты (>51) - old.philol.msu.ru/ )

• MSU-LGCLL:: O.V. Kukushkina, A.A. Polikarpov, D.V. Khmelev - Authorship
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• Footnotes

Symbolic circuit-matrix processor and evaluator . ... This software is reliable over the range of benchmark circuit complexity (both *.CIR and *.MAT file). ... SYMBOL is a symbolic-algebra package which in contrast to REDUCE, MACSYMA, MAPLE, MATHEMATICA, MathLAB, MathCAD and other known multi-purpose systems is especially intended for analysis of any lumped, linear, time-invariant circuit. ... pure ASCII text . ... CIRSYM - SYMbolic CIRcuit processor used to format ASCII text file *.out for CALCSYM. ...

Еще в разделе: (Показать все результаты (>10) - astrometric.sai.msu.ru/ )

• Symbolic circuit processor
• Symbolic matrix processor

Project management and organisation 9 9.1 Project management and organisation Introduction In accordance with the draft X-Ray Free-Electron Laser ( XFEL ) legal texts (Convention and Ar ticles of Association): · the construction and operation of the European X-ray FEL Facility shall be entrusted to a limited liability company, the XFEL GmbH ; · the XFEL GmbH and Deutsches Elektronen Synchrotron ( ... Figure 9.2.1 Organisation char t of the XFEL GmbH for the operation phase. ...

Еще в разделе: (Показать все результаты (>128) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/conf/XFEL/XFEL-TDR_Chapter10_Cost-Time%20Schedule.pdf
• Альфа-распад (измерения)
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов

E-mails : s_piskarev@pochta.ru s_piskarev@hotmail.com . Phone (office) : + 7 (Russia) - 495 (Moscow) - 939 - 22-82 . ... Fax and phone : + 7 (Russia) - 499 (Moscow) - 191-53-12 . My Bosses at Home and at the Universities Sergey Piskarev is Leading Scientific Fellow at the Moscow State University, Moscow, Russia. ... My book "Differential equations in Banach space and it's approximation." (in Russian) . ... Bibliography on Differential Equations in Abstract Spaces . ...

Еще в разделе: (Показать все результаты (>58) - srcc.msu.ru/ )

• Laboratory of Informatics
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided
• V.B.Semikoz, D.D.Sokoloff, J.W.F. Valle, Lepton asymmetries and primordial

European Treaty Series - No. 165 CONVENTION ON THE RECOGNITION OF QUALIFICATIONS CONCERNING HIGHER EDUCATION IN THE EUROPEAN REGION Lisbon, 11.IV.1997 2 ETS 165 ­ Recognition Qualifications Higher Education in the European Region , 11.IV.1997 The Parties to this Convention , Conscious of the fact that the right to education is a human right, and that higher ... 3 6 ETS 165 ­ Recognition Qualifications Higher Education in the European Region, 11.IV.1997 Section III. ...

Еще в разделе: (Показать все результаты (>37) - www.socio.msu.ru/ )

• Вестник МГУ
• English version - Социологический факультет МГУ

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... 2008. NONHOLONOMIC MECHANICS Gauss Principle and Realization of Constraints V. V. Kozlov* V.A. Steklov Institute of Mathematics, Russian Academy of Sciences, ul. ... From (3) it immediately follows that an actual motion is a virtual one. ... x (10) If one considers this relation as a definition of virtual motions, then the generalized Gauss principle leads to the equation x=- Е ,x x, (x, x) V x which also has the integral of energy, but differs from the initial equation (9). ...

Еще в разделе: (Показать все результаты (>107) - ics.org.ru/ )

• http://ics.org.ru/upload/iblock/efa/rm_70_1167.pdf
• http://ics.org.ru/upload/iblock/daf/135-on-justification-of-gibbs-distribution_ru.pdf
• http://ics.org.ru/upload/iblock/972/RCD752.pdf

... Academic Programmes . ... Russian Language Programmes . ... A balanced program of speaking, listening, writing and reading skills ensure that all students make progress as quickly as possible. ... Listening/Speaking : you will be able to understand basic instructions or take part in a basic factual conversation on a predictable topic. ... Reading : you will be able to read quickly enough to cope with an academic course, to read the media for information or to understand non-standard correspondence. ...

Еще в разделе: (Показать все результаты (>25) - www.cie.ru/ )

• Information about Moscow :: Useful Information :: CIE
• Admissions :: CIE
• Apply Online

Welcome to Fourmilab 's calendar converter! ... In the Julian calendar every fourth year is a leap year in which February has 29, not 28 days, but in the Gregorian, years divisible by 100 are not leap years unless they are also divisible by 400. ... The average length of a year is 365.2468 days compared to the actual solar tropical year (time from equinox to equinox) of 365.24219 days, so the calendar accumulates one day of error with respect to the solar year every 216 years. ... Excel serial day: . ...

Еще в разделе: (Показать все результаты (>9) - sbmg.geol.msu.ru/ )

• Europrobe2

... Find the Brillouin zone for a 2D honeycomb lattice (lattice parameter d) and transform it into a hexagon. ... Compare the energies and the RMS charge radii electrons, in units of e). 1 2 (r )d3 x thus obtained ((x) is the total charge density of two 4. Find the density profile n(r) for an atom with the nucleus charge -Z e using the Thomas­ Fermi equation. ... Introducing the wavefunction (x) containing the low-energy degrees of freedom, find the effective wave equation for it. ...

Еще в разделе: (Показать все результаты (>4) - theorphys.phys.msu.ru/ )

The name of film studio "Eh-Film" should be understood as phonetical reverberation of two key letters in ElectroChemistry. ... Academician Frumkin arrives to his Dept in Moscow University (usually he had spent two days at the Dept, and other days were devoted to his Institute). Staff is waiting for Frumkin in his office, and disappear from the office when Frumkin approaches the Dept. ... Finally Frumkin proposes the student to continue his experimental work for two weeks. ...

Еще в разделе: (Показать все результаты (>65) - electr003.chem.msu.ru/ )

• RADEN Data Bank
• Galina A. Tsirlina: Eduard L. Nagaev. Scientific heritage

... О факультете . ... Master In Ecology . ... Master (MSc) . ... A Master will be able to successfully deal with conceptual issues and practical problems related to various subflields of ecology and environmental science. ... Enables the students to develop biopolicies to deal with ecological problems caused by environmental pollution, the disruption of the ecological matrix of an area, and biodiversity-endangering factors. ... Lectures . ... Д 501.001.20 - все защиты . ... Биологический факультет МГУ ...

Еще в разделе: (Показать все результаты (>3) - www.bio.msu.ru/ )

... Master's Programme . ... On-line консультант . ... Master s Programme Enterprise Resource Management System has been developed basing on methodology from SAP, Oracle, Microsoft Companies, as well as the experience of national higher school and international universities. The key objective (mission) of the Programme is to educate professionals in the organization and implementation of projects aimed at deployment and maintenance of ERP systems at domestic enterprises. ...

Еще в разделе: (Показать все результаты (>5) - erp.cmc.msu.ru/ )

Cell Biology International 27 (2003) 293­294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>31) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/alieva99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Yuko2006_gtc_990.pdf

... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>6) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

. Home . Structure of Data . Description . Catalog . Publications . VO . ЮБ 2000 . 11:14:20.2 . ЮД 2000 . -57:33:04 . l . 290.172 . b . 2.895 . diameter . 14.0' . (m - M) 0 . 11.4 0.05 . distance . 1900 50 pc . E(B - V) . 0.08 0.01 . log(t) . 9.65 0.05 . (J, J-H) isochrone VOTable . 2MASS data VOTable . Developed by the Team . Send us your questions or feedback

Еще в разделе: (Показать все результаты (>209) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Berkeley 53
• SAI OCL Catalog Berkeley 71
• SAI OCL Catalog Berkeley 72

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... BDRG . ... DEPRON . ELFIN-L . ... The satellite ?Mikhailo Lomonosov? is based on the platform of the spacecraft ?Kanopus-B? developed by the All-Russia reasearch and development institute of electromechanics named after Iosiphyan (VNIIEM). ... Scientific equipment will weight about 120 kg, while the total weight of the satellite will be about 450 kg. ...

Еще в разделе: (Показать все результаты (>28) - lomonosov.sinp.msu.ru/ )

• News | Университетский спутник "Ломоносов"

... Начало www.99ru.ru Религия и эзотерика Христианство 1314 . ... История.Философия . ... Застольные беседы (речи) Мартина Лютера 1566г репринт оригинала Luthers Tischreden Немецкий Готический шрифт . ... Martin Luther died on the 18th of February, 1546, and the first publication of his "Table Talk"-Tischreden-by his friend, Johann Goldschmid (Aurifaber), was in 1566, in a substantial folio. ... He began his studies at the University of Wittenberg in 1537, where he attached himself closely to Luther. ...

Еще в разделе: (Показать все результаты (>12) - www.bukivedi.ru/ )

• www.99ru.ru - 1984 6242