... Дисциплины . ... On-line консультант . ... Главная Дисциплины Основы IT - менеджмента . Лектор и автор курса Козлов Д.Д. В курсе рассматриваются вопросы выстраивания экономически эффективной ИТ-инфраструктуры предприятия на основе сервисно-ориентированной модели ITSM. В рамках курса изучается библиотека IT Infrastructure Library и рассматриваются процессы управления информационно-коммуникационной инфраструктурой, предоставления и поддержки услуг. ... Copyright ВМиК МГУ , 2008 . ...

Еще в разделе: (Показать все результаты (>6) - erp.cmc.msu.ru/ )

... COMPUTATIONAL . ... Scientific description and computerization of archives . Researchers of the Rare Books and Manuscripts Department of the Scientific Library of Moscow State University, the Orthodox Svyato - Tikhonovsky University and the Laboratory for Computational Lexicography are working on the scientific description of I. A. Ilyin?s personal archives. ... The conception of scientific description and computerization of archives was developed within the framework of this project. ...

Еще в разделе: (Показать все результаты (>20) - lcl.srcc.msu.ru/ )

... Юрий (admin) Новости R , Statistics One , используем R , статистика 2 Comments . Statistics One, Assignment One #Read data, plot histograms, get descriptive library(psych) #Read the data into a dataframe called working_memory working_memory . Как повысить ТИЦ и PR от 100 рублей Statistics One, Lecture 3, example script . ... Дайджест психологических исследований . ЖЖ-сообщество ?RU_SPSS? ... Статистика блога . ... R-советы: Экономим время и место на диске путем сжатия файла данных . ...

Еще в разделе: (Показать все результаты (>21) - tukachev.flogiston.ru/ )

• Statistics One, Lecture 3, example script
• Statistics 1, Assignment 2
• Tag: Statistics One

... Annex (e.g. 3.1) (3) Paragraph/ Figure/Table/ Note (e.g. Table 1) 4 Type of comment2 5 Comment (justification for change) by the MB Date: (6) Document: (7) Secretariat observations on each comment submitted Proposed change by the MB RU RU RU RU 2 2 2 2 Row 2 Row 4 Row 4 Row 5 ed ed ed te SEPs are not fluxes , but particles It is desirable to add that Wolf number is also known as the sunspot number. ... CLOSED: Accepted and implemented in modified form CLOSED: Accepted and RU 2 Row 16 . ...

Еще в разделе: (Показать все результаты (>8) - srd.sinp.msu.ru/ )

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out
• ConClus

... Начало www.99ru.ru Религия и эзотерика Христианство 3889 . ... Введите код товара из каталога. автор Winifred Gallagher . Working on God (Modern Library Paperbacks) . ... 3889 . Winifred Gallagher . ... Speaking to Americans who are skeptical about religion, but nonetheless feel a spiritual hunger, Winifred Gallagher offers a humorous and profound discussion about the state of national spirituality. ... Most important, I'm already thinking of religion as a process of working on God. ...

Еще в разделе: (Показать все результаты (>16) - www.bukivedi.ru/ )

Courses Overview Human resources management (English) The course is aimed at creating an overall understanding of human resources (HR) management system. ... Key topics: main theories and concepts of human resources management, personnel planning, HR policies, personnel selection and hiring, personnel development, career management. ... Insurance and risks The course presents an overview of economic, legal, and administrative bases of insurance. ... Key topics: depending on a company profile. ...

Еще в разделе: (Показать все результаты (>172) - www.mgubs.ru/ )

• Международная конференция в Риге 'Define Europe - Different Sculptors, One

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>22) - observ.pereplet.ru/ )

... Ph.D., lecturer, Faculty of Philosophy, Lomonosov Moscow State University; associate professor, M.A. Sholokhov Moscow State Humanitarian University. ... Today counter-terrorist struggle is carried out not only through special military operations, but also by means of a complex system of communication management. ... Public Administrarion". 119991, Room A-710, Shuvalovskiy building, Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>261) - ee-journal.spa.msu.ru/ )

Выпускники 1968 . ... Список выпускников . Этот список мы не контролируем . ... список не полный . ... Список выпускников из зарубежья . ... Web - ...

Еще в разделе: (Показать все результаты (>23) - foroff.phys.msu.ru/ )

.., . .. (e-mail: irene1985@list.ru) , , , , , , , , , , personalized mass society, communicative spiral, Communication, media, no-communication, feedback, policy interpretation, symbolic exchange, sociology, totizm . , , . The article analyzes non-communication concept? as a new communication model. Special attention is given to the key theses of the concept developed within different paradigms in French media sociology. The author presents contrastive analysis of these theses.

Еще в разделе: (Показать все результаты (>50) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/4/11.pdf
• http://www.socio.msu.ru/vestnik/archive/2013/1/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2011/4/05.pdf

... Different neuronal Na(+)/K(+)-ATPase isoforms are involved in diverse signaling pathways. ... Inhibition of rat neuronal Na(+)/K(+)-ATPase alpha3 isoform at low (100 nM) ouabain concentration led to activation of MAP kinase cascade via PKC and PIP(3) kinase. ... These data are the first demonstration showing participation of ouabain-resistant (alpha1) and ouabain-sensitive (alpha3) Na(+)/K(+)-ATPase isoforms in diverse signaling pathways in neuronal cells. ...

Еще в разделе: (Показать все результаты (>106) - biochem.bio.msu.ru/ )

• Binding of ouabain and marinobufagenin leads to different structural changes in
• Chaperone-like activity of monomeric human 14-3-3zeta on different protein
• The pivotal role of the beta 7 strand in the intersubunit contacts of different

... About the Institute . ... The International Summer School "Computer Technologies of Engineering Mechanical Problems" is a program designed for University students studying different branches of mechanics and engineering. ... The Summer School is organized in the Institute of Mechanics of Lomonosov MSU. ... The tradition of the Summer School arose from the cooperation between the Institute of Mechanics of Lomonosov MSU and Chien Hsin University of Science and Technology, Taiwan ( www.uch.edu.tw ). ...

114. Center on Russia and the United States :: SUNY-MSU Partnership

---

Астронет | Научная сеть | ГАИШ МГУ | Поиск по МГУ | О проекте | Авторам

Комментарии, вопросы? Пишите: info@astronet.ru или сюда