... 07.04.2016 (Thursday) Session 1 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:20 11:20-11:40 ­ ­ ­ ­ ­ (chairman ­ M. Stynes) N. Kopteva V. Andreev H.-G. Roos S. Franz, H.-G. Roos A posteriori error estimates for singularly perturbed reactiondiffusion problems on anisotropic meshes. ... Numerical solution of a singularly perturbed initial-boundary value problem with a Neumann condition for a parabolic equation. ... Boundary layer solutions to time-periodic singularly perturbed parabolic problems. ...

Еще в разделе: (Показать все результаты (>9) - math.phys.msu.ru/ )

... Faculty of Physics . ... Research Centers . ... Search Faculties Staff . Education . ... Any division Budget Depatment Center of Computer Physics (CCP) Center of Education Quality Control Center of Hydrophysical Studies Center of Information Systems and Technologies (CIST) Chair of Acoustics Chair of Astrophysics and Stellar Astronomy Chair of Atomic Physics , Plasma Physics , and Microelectronics Chair of Biophysics Chair of Celestial Mechanics, Astrometry, and Gravimetry ...

Еще в разделе: (Показать все результаты (>2) - phys.msu.su/ )

... Публикация в Интернете электронных журналов . ... Использование дистанционных образовательных технологий в обучении . ... Использование дистанционных образовательных технологий в преподавании химии . ... Информация о дистанционном обучении на Химическом факультете МГУ . ... Возможность обучения на основе фактически индивидуальных занятий с преподавателями выбранного вуза . ... Изучение вопросов восприимчивости дистанционного обучения и адекватности оценок знаний методом дистанционного тестирования ....

Еще в разделе: (Показать все результаты (>4) - inpro.msu.ru/ )

... Co-Chairs: Andrius Baltuska (Technical Univ. of Vienna, Austria), Alexei Zheltikov (Lomonosov Moscow State Univ., ... Topics include, but are not limited to, pattern formation in optical systems, novel optical systems for nonlinear dynamics such as quantum dot lasers, hybrid devices, microlasers, fiber lasers; complex dynamics of nonlinear optical systems such as lasers or OPOs; instabilities in semiconductor lasers by injected signal, optical feedback, or multimode dynamics; ...

Еще в разделе: (Показать все результаты (>10) - iconolat13.phys.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...

Еще в разделе: (Показать все результаты (>28) - dynamo.geol.msu.ru/ )

• Summaries of articles
• Professional experience of V.Zakharov

This module provides for user authentication using DBM files. ... Source File: mod_auth_dbm.c . ... This module provides for HTTP Basic Authentication, where the usernames and passwords are stored in DBM type database files. ... AuthDBMGroupFile . ... Module: mod_auth_dbm . ... The AuthDBMUserFile directive sets the name of a DBM file containing the list of users and passwords for user authentication. ... This program can be used to create and update DBM format password files for use with this module. ...

Еще в разделе: (Показать все результаты (>62) - neptun.sai.msu.ru/ )

• Apache module mod_auth
• Apache module mod_auth_db
• Installing Apache on TPF

Norwegian Libraries: . ... ARLIS - Kunstbib: Norwegian Art History Bibliography. ... The Norwegian Museum of Architecture . ... Art Museums . ... Henie-Onstad Art Center - Hovikodden: Norway's first Museum of Fine Arts on Internet. The Astrup Fearnley Museum of Modern Art . ... National Museum of American Art . Dallas Museum of Art . ... Electra '96 Henie Onstad Art Center's Project for Electronic Media. ... WWW-Library: History of Art . ... News: rec.fine.arts . ... News: k12.ed.art . ...

Еще в разделе: (Показать все результаты (>15) - www.hist.msu.ru/ )

• The Laboratory of Historical Information Sciences

The Database of Close Binary Systems . ... Team . ... This web-based interactive database is being developed and maintained by a team at the Sternberg Astronomical Institute of the Moscow State University . The project is an on-line extension of our catalogue on "Highly Evolved Close Binary Stars" (volumes I, II) published by Gordon and Breach in 1996. As of November 2009, the database (both the software and the content) is in its development/testing phase. Sternberg Astronomical Institute ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Stellar Astrophysics Department

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>61) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/referenc/BOH_VEC.DoC
• Anis. Page2
• TES. Processing