Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... Unless in many other approaches to the analysis of different signal coupling, the information entering the analysis of synchronization in our approach is explicitly represented in the form of elementary, instantaneous events (the change-points). ... Hence the use of correlation/coherency estimates in parallel with change-point analysis seems to be quite rational. ...

Еще в разделе: (Показать все результаты (>60) - brain.bio.msu.ru/ )

• Analysis of change-point synchronization in multi-channel EEG
• EEG feature extraction

A.Nekipelov Modernization of Basic Research in Russia: Russian Academy of Sciences ( RAS ) Vision Joint Session of Russian Academy of Sciences, Institute of France Academy of Sciences and Academy of Technology of France Paris, 2010, September 28 1 RAS in Russian Basic Science Potential (per cent, 2008) Russian Federation Research Organizations 100,0 RAS 12,7 Overall Personnel ... Who is the main actor in research: an institute or a laboratory? ...

Еще в разделе: (Показать все результаты (>21) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/files/rossipr12.pdf
• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011_en.pdf

... High difference of refractive indexes of bismuth-substituted yttrium iron garnet Bi:YIG and SiO2 layers provides a strong spatial localization of the optical field in Bi:YIG layers, which leads to manifold Faraday rotation enhancement at the photonic band edges. ... Relation between the enhancement of the Faraday rotation and localization of optical field in magnetic layers is treated as a Borrmann-type effect. ... The Faraday rotation angle for the MPC pc also decreases in this spectral region. ...

Еще в разделе: (Показать все результаты (>67) - nanolab.phys.msu.ru/ )

• http://nanolab.phys.msu.ru/sites/default/files/jap111_07a944_2012.pdf
• http://nanolab.phys.msu.ru/sites/default/files/apl94_231122_2009.pdf
• http://nanolab.phys.msu.ru/sites/default/files/jmmm2015.pdf

... GOES corrected results are wrong, because the publication Smart D.F. and M.A. Shea, Comment on the use of GOES solar proton data and spectra in solar dose calculations, Radiation Measurements 30 (1999) 327-335 was erroneous (see "The issues...." above. ... The criticism of the use of the log-normal distribution for the data fit in Feynman et al. is excessive. Indeed, Feynman et al. use only the high intensity part for the fit making the results almost independent of the low energy part. ...

Еще в разделе: (Показать все результаты (>7) - srd.sinp.msu.ru/ )

• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_1.pdf
• http://srd.sinp.msu.ru/nymmik/models/quaghebeur_2.pdf
• http://srd.sinp.msu.ru/nymmik/models/bazilevskaya_1.pdf

... Географии мирового хозяйства . ... Выберите кафедру . ... Кафедры . ... Учебно-методический отдел . ... НИЛ возобновляемых источников энергии . ... Distribution and composition of hydrocarbons in the coastal waters of the north-eastern part of the Black Sea . The results of the study of hydrocarbons in surface waters of the Blue and Gelendzhik bays of the Black Sea in relation to the content of lipids and chlorophyll and the concentration and composition of suspended matter are presented. ...

Еще в разделе: (Показать все результаты (>215) - www.geogr.msu.ru/ )

• CONTENTS ?3 - 2009
• CONTENT 1 (4) 2011
• CONTENTS ?6 - 2011

... We calculate field dependence of the electron drift velocity using several sets of the material parameters that can be found in the literature, and the results are compared with the available experimental data. ... 0 2 Electronic mail: dmitriev@lt.phys.msu.su. ... The calculated field dependence of the drift velocity vd for different sets of InN material parameters, the lattice temperature is 77 K, the free electron, and doping concentrations are 9 1018 cm-3. ... Phys. 109, 023706 2011 FIG. ...

Еще в разделе: (Показать все результаты (>18) - lizard.phys.msu.su/ )

• http://lizard.phys.msu.su/home/science/Masyukov-Dmitriev-11-JMathSci-InN.pdf
• http://lizard.phys.msu.su/home/science/jap-06.pdf
• http://lizard.phys.msu.su/home/science/Dmitriev-Ivanov-Xoxlov-11-JMathSci-Diffuser.pdf

. Fig. 1. A - Absorption spectrum of phytoplankton suspension from central area of the Baltic Sea. Values of absorption coefficients are averaged over spectral regions 400-550 nm (afl) and 400-700 nm (a S ). B - Spectrum of the light used to excite chlorophyll fluorescence in PrimProd fluorometer (1), and spectral distribution of underwater illumination in clear water at depths of 1 (2), 5 (3), and 20 m (4). Fig. 2. Histograms of km (A) and I 1/2 m (B) distribution, obtained at the stations of Baltic S ea.

Еще в разделе: (Показать все результаты (>17) - www.biophys.msu.ru/ )

• Как отмечалось выше, обилие (по Fo) и фотосинтетическая активность

Title Author Key words Suicides in the United Kingdom (1981­2011): dynamics, trends, especially S.V. Bogdanov, J.S. Bogdanova suicide, UK, men, women, age groups The dynamics completed suicides in the UK over the years 1981­2011. Discusses the distribution of suicides by sex, age. The geographical distribution of suicide mortality of the UK population by region. Abstract

Еще в разделе: (Показать все результаты (>47) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2014/3/00.pdf

... We have assumed that in statistical equilibrium, the probability distribution density depends only on the total energy. ... As it is shown in Refs. [1, 2], in a billiards, the probability distribution density as a function of time t (this function satisfies the classic Liouville equation) necessarily has the weak limit as t ±. ... The crucial idea of our approach is : transition to thermo dynamical (statistical) equilibrium is equal to replacement of the distribution (12) with its weak limit. ...

Еще в разделе: (Показать все результаты (>109) - ics.org.ru/ )

• Institute of Computer Sciences - Publications

About particularities of intensities distribution in cross-section of powerful laser beams . ... The time of the beam aperture scanning was about 10 -2 - 10 -3 s. On occasion to measure the intensity distribution in the beam cross-section the small spherical mirrors with the diameter of about 5 - 10 mm were placed instead of mirror fringes. ... Such technique allowed by character of a luminescence corundum to investigate transformations of spatial distribution of intensity in a laser beam. ...

Еще в разделе: (Показать все результаты (>6) - optics.sinp.msu.ru/ )

• НЕСТАЦИОНАРНЫЕ РЕЖИМЫ ГЕНЕРАЦИИ В ПРОТОЧНЫХ ЛАЗЕРНЫХ СИСТЕМАХ И НОВЫЕ

THE JOURNAL OF CHEMICAL PHYSICS 129, 244707 2008 Osmotic pressure acting on a semipermeable shell immersed in a solution of polyions Roumen Tsekov,1,2 Mikhail R. Stukan,3,a and Olga I. Vinogradova1 1 A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Russian Academy of Sciences, 31 Leninsky Prospect, 119991 Moscow, Russia 2 DWI, RWTH Aachen, Pauwelsstr. ... A ratio of an osmotic pressure exerted on the shell to the osmotic pressure of the bulk solution as a function of iR. ... Chem. ...

Еще в разделе: (Показать все результаты (>29) - nanofluidics.phys.msu.ru/ )

• http://nanofluidics.phys.msu.ru/paper/JCP2014-2.pdf
• http://nanofluidics.phys.msu.ru/paper/jcp2012_1.pdf
• http://nanofluidics.phys.msu.ru/paper/vinogradova-lobaskin-2012.pdf

... 3D magnetosphere . ... Data . ... Magnetosphere . ... Magnetic field at the selected point Module of the Magnetic field distribution along Sun-Earth line Noon-Midnight magnetosphere structure . ... Point coordinates, where magnetic field will be calculated: . ... Magnetic field at MD outer edge . ... Magnetic field at TC inner edge . ... Distance to external edge of MD . ... Distance to inner edge of MD . ... Magnetopause stand-off distance . ... Distance to inner edge of geotail current sheet . ...

Еще в разделе: (Показать все результаты (>7) - swx.sinp.msu.ru/ )

... A Primer from the Reform of Personal Income Taxation in Russia Introduction. ... However, to use the welfare function one needs to aggregate individual preferences that can also be unknown. ... The derivations lead to the conclusion that the optimal marginal income tax rate is increasing as the elasticity of labor supply increases. ... In this paper we obtain the characteristics of the labor supply for different population groups to get the elasticities of labor supply with respect to a post tax...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./briedis.pdf

Journal of Cell Science 112, 2277-2289 (1999) Printed in Great Britain © The Company of Biologists Limited 1999 JCS0417 2277 Contribution of plus and minus end pathways to microtubule turnover I. A. Vorobjev1, V. I. Rodionov2, I. V. Maly1 and G. G. Borisy2,* 1Laborator 2Laborator y of Cell Motility, A. N. Belozersky Institute, Moscow State University, Moscow, Russia y of Molecular Biology, University of Wisconsin, 1525 ... Distal (plus) ends of MTs displayed dynamic instability. ...

Еще в разделе: (Показать все результаты (>34) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf
• http://cellmotility.genebee.msu.ru/html/articles/grigoriev99.pdf
• http://cellmotility.genebee.msu.ru/html/articles/alieva2000.pdf

... The study of adaptive variability, i.e. the study on the population level of the physiological adaptation of the human organism to a variety of environmental conditions, is the main purpose and the basic principle of physiological anthropology. ... Regional rates of hormonal activity of indigenous population of different ethno-territorial groups that we have elaborated broaden our notions about common conformities of age variability and aging and the reasons of these processes. ...

Еще в разделе: (Показать все результаты (>24) - www.anthropos.msu.ru/ )

• http://www.antropos.msu.ru/vestnic/e2014_2.doc
• http://www.antropos.msu.ru/vestnic/e2015_1.doc
• НИИ и Музей антропологии | Вестник Московского университета. Серия XXIII.

Proceedings of ICHIT- 06 26 February - 5 March 2006, Moscow, Russia LINEAR AND NONLINEAR ANALYSIS OF NUMERICAL METHOD FOR DNS OF TURBULENT CONVECTION IGOR B. PALYMSKIY Modern Academy for Humanities, Novosibirsk Branch , Novosibirsk, Russia, 630064 palymsky@hnet.ru Abstract We study the spectral characteristics of the numerical method for DNS of turbulent convectional flows. ... So far the full numerical simulation of 3-D turbulent convection is very complex problem demanding the large resources. ...

Еще в разделе: (Показать все результаты (>19) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2006/CD/Palymskiy2.pdf

... Malkhazova S.M. (ecology, medical geography), Doctor of Geography. ... Biology, Ecology with the fundamentals of biogeography , Biogeographic basis for nature conservation, Mathematical methods in biogeography , Methods of field studies, Diversity of organisms, Ecology of human, Biogeographical mapping , GIS in biogeography and ecology , Ecology of organisms, Biogeography of foreign countries, Biogeography of Russia, Bioindication and Biomonitoring, Geography of utilization of ...

Еще в разделе: (Показать все результаты (>32) - eng.geogr.msu.ru/ )

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>26) - foroff.phys.msu.ru/ )

• Papers of our group

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• Comparison of protein phylogeny reconstruction methods

... Reply | Edit | ... Copyright (c) 1995, 2008, Oracle and/or its affiliates. ... The HelloWorldApp class implements an application that * simply prints "Hello World!" to standard output. */ class HelloWorldApp { public static void main(String[] args) { System.out.println("Hello World!" ... I notice it's been on trending for hours. Is it a chemical formula or anything else? ... Приглашаются программисты на РНР, 1С и VBA . ... edit: в комментах еще более питонистые варианты!) ...

Еще в разделе: (Показать все результаты (>2405) - www.fds-net.ru/ )

• шифрование. интересует мнение параноиков. - Public forum of MSU united student
• distributed vcs - Public forum of MSU united student networks
• oink закрыли - Public forum of MSU united student networks