... DESCRIPTION General Catalog of Variable Stars (GCVS database) . ... Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1990, General Catalogue of Variable Stars, 4rd ed., vol.IV, Nauka, Moscow. Kholopov P.N., Samus N.N., Durlevich O.V., Kazarovets E.V., Kireeva N.N., Tsvetkova T.M., 1992, General Catalogue of Variable Stars, 4rd ed., vol.IV, Bull. ... Kazarovets E.V., Durlevich O.V. Editor-in-Chief Samus N.N., 1998, New Catalogue of Suspected Variable Stars. ...

Еще в разделе: (Показать все результаты (>135) - sai.msu.ru/ )

• General Catalogue of Variable Stars: Vols I-III (the new electronic version).
• GCVS Research Group: Recent publications
• GCVS Query forms

Abstract British Foreign and Defence policy in the light of the Ukrainian crisis 2014 Introduction After a decade of interventionism alongside the US, a feeling of "war-weariness and warwariness" (as coined by ex-Chief of the General Staff General Lord Richard Dannatt) is prevalent in the British forces as well as the British society as a whole. ... As an example, one of the main targets was Mykola Azarov, former PM of Ukraine until Januray 2014 and Olena Lukash, a former Minister of Justice. ...

Еще в разделе: (Показать все результаты (>66) - www.spa.msu.ru/ )

• http://www.spa.msu.ru/uploads/files/bakalavriat/03.04.13.pdf
• Visa support application form

... О UNИX . ... HelpOnTables . ... Table Markup . ... General table layout and HTML like options . ... Line breaks within cells . ... Bulleted lists and other complex content within cells To create a table, start & end a new line using the table marker; two 'pipe' characters " || ... top left cell || top right cell || || bottom left cell || bottom right cell || ... Just use CSS-formatted styles and it will be inlined in the generated HTML tag. <style="..."> will put that style info into cell (td) html ...

Еще в разделе: (Показать все результаты (>196) - uneex.mithril.cs.msu.su/ )

• HelpOnActions/AttachFile - UNИX
• HelpOnAutoAdmin - UNИX
• Index of /static/AltDocs_informatika1/Book1/5_html/8_form

VISA SUPPORT FORM |Family name| ... Date of | birth | __________________________________ If there is the second (or moreover) citizenship they are specified through a point State of birth ____________________ place of birth _______________________________________ country exact place of birth State of inhabitancy _________________ region___________________________________________ country region in the state of inhabitancy The closest Russian Consulate where you will ask for visa: ...

Еще в разделе: (Показать все результаты (>42) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/eng/docs/En_cont_last1.doc

... In English . Anatoliy A. Polikarpov Chronological Morphemic and Word-Formational Dictionary of Russian: Some System Regularities for Morphemic Structures and Units . In Russian . ... L.I. Kolodyazhnaya, A.A.Polikarpov . ... Polikarpov A.A. Menzerath's Law for Morphemic Structures of Words: A Hypothesis for the Evolutionary Mechanism of its Arising and its Testing. ... A.A. Smirnov . ... V.P. Grigoryev, L.I. Kolodyazhnaya, L.L. Shestakova . ... V.P. Grigoryev . ... Anatoliy A. Polikarpov . ...

Еще в разделе: (Показать все результаты (>61) - old.philol.msu.ru/ )

• Dmitry V. Khmelev: List of Publications
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics
• Human Language - Язык Человека

1) Soil Science Faculty, Moscow State University, Moscow 119899, Russia; . ... We assessed critical loads of acid deposition and their exceedance for forest soils in the European part of the former Soviet Union using a simple balance method and mapped them within 1.0° в 0.5° longitude per latitude grid cells. ... The uncertainty in the estimated critical load values can be rather large due to uncertainty in critical chemical values for the soil as for a receptor, assessment method and data. ...

Еще в разделе: (Показать все результаты (>37) - eco.soil.msu.ru/ )

• Norwegian-Russian cooperation in the border area
• Polluting metals in Russian terrestrial ecosystems: chemistry, dynamics, and
• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION

e-mail: baggio-18@yandex.ru) , , , , , , Political system, trade unions, interest groups, lobbying, corporatism, Tripartism , . Trade unions form a vital institute of the society, which influences the stability of the political system. ... Current article contains analysis of the state of the trade unions in today's Russia, perspectives of its further development, and also comparative analysis of trade unionism and its significance in several foreign countries. ...

Еще в разделе: (Показать все результаты (>69) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/eng/archive/2015/4/21.pdf
• http://www.socio.msu.ru/documents/umo/bologne/CONVENTION%20ON%20THE%20RECOGNITION%20OF%20QUALIFICATIONS%20IN%20THE%20EUROP.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2015/3/05.pdf

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . ... The effect of light on the reactivity of nanocrystalline metal oxides coated with quantum dots . The project aims to create nanocomposites based on nanocrystalline oxide semiconductor SnO 2 , In 2 O 3 , ZnO, sensitized nanocrystals (quantum dots) CdSe and study their interactions with the gas phase under irradiation with light. ... Activation reactions light gives more control reactivity of materials. ...

Еще в разделе: (Показать все результаты (>54) - www.lssm.inorg.chem.msu.ru/ )

Multiple Supernovae in the same galaxy . ... When looking at these images, you should note just how big these galaxies are. ... SN 2009as and sn2009gb images sub-page . ... LOTOSS discovered 2003hl , and a few weeks later JM Llapasset was taking an image of it, and he noticed a new star . ... Supernovae 2002cv and 2002bo in NGC 3190 2002cv was discovered by Campo Imperatore Observatory while observing 2002bo in IR. 2002cv was only visible in IR must likly due to it being behind a dust lane. ...

Еще в разделе: (Показать все результаты (>442) - www.rochesterastronomy.org/ )

• Supernova 2002ao in UGC 9299
• Supernova images - Best of
• Nova in M31 2000 4

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>18) - mouse.genebee.msu.ru/ )

• ConClus

... Department . ... Contacts . ... The department offices are at the 6th and 7th floor in the Lomonosov MSU 2nd educational building (Faculty of Computational Mathematics and Cybernetics): 714 (scientific secretary of the department), 615a (head of the department), 666, 717. ... CMC Faculty at Google Maps and Yandex.Maps . ... Scientific secretary of the department, Assoc. ... Deparment of the Automation for Scientific Research (ANI) . ... 2008?2016 ASR Department , CMC Faculty , Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>10) - ani.cmc.msu.ru/ )

• Contact information

Selected Scientific Journals . Search Engines . ... Discover and search 103,000 databases and specialty search engines. ... Search articles for free at FindArticles.com, a searchable online archive of quality magazine and journal content. ... The Main distinctions of Scirus from existing search engines are: . ... Users can use the Search Engine Selector to choose the engine that suits the requirements of the search with the option of narrowing the search to Scirus, Web or journal sources. ...

Еще в разделе: (Показать все результаты (>197) - www.genebee.msu.ru/ )

• razjivin_dept
• Лаборатория регуляции белкового синтеза
• TreeTop - Phylogenetic Tree prediction

International Symposium Biological Motility: New facts and hypotheses ================================================= Pushchino , Moscow region, Russia May 12-14, 2014 Chairman of Organizing Committee Prof. Zoya Podlubnaya Institute of Theoretical and Phone (4967)739269 Experimental Biophysics RAS Fax (4967)330553 Pushchino , Moscow region E-mail: motility2014@iteb.ru 142290, Russia Preliminary information Dear colleagues, The ... Deadline for sending abstracts is 1 of March 2014. ...

Еще в разделе: (Показать все результаты (>2) - cytol.bio.msu.ru/ )

. People on #C4ACTbE as of 18 Jan 2001 18:45 MSK . Nickname . Status . User@Host . C4ACTbEP . idle . This is me, the channel bot. XAM[c] . idle . u0948@mvs.imm.uran.ru . Igorek . idle . igorek@kronos.psu.ru . Berendeev . - . graffity@ts16-a82.dial.sovam.com . Created by quesedilla v3 via eggdrop This page is automatically refreshed.

Еще в разделе: (Показать все результаты (>6) - asa.guru.ru/ )

Еще в разделе: (Показать все результаты (>4) - termogaz.imec.msu.ru/ )

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>48) - observ.pereplet.ru/ )

• MASTER GRB101123A prompt observations
• MASTER team

Cameras · ­ · · · · · · · · ! MATLAB · MATLAB · Let's design a camera Idea 1: put a piece of film in front of an object Do we get a reasonable image? ... Slide by Steve Seitz Shrinking the aperture Adding a lens A lens focuses light onto the film · Thin lens model: ­ Rays passing through the center are not deviated (pinhole projection model still holds) Slide by Steve Seitz Adding a lens focal point f A lens focuses light onto the film · Thin ...

Еще в разделе: (Показать все результаты (>18) - imaging.cs.msu.ru/ )

• http://imaging.cs.msu.ru/files/courses/ipintro2012/Lec_Pt3_inpaint_my.pdf
• http://imaging.cs.msu.ru/pub/2013.PRIA.Mamaev_Lukin_Yurin.HermiteNLM.en.pdf

... Gaseous discs in NGC 252 and in NGC 4513 have decoupled kinematics, and the ionized gas of their rings is certainly excited by young stars. ... Two other, quite isolated S0 galaxies with the UV rings, IC 522 and NGC 446, demonstrate the shock-dominated gas excitation in the UV-detected rings, so their rings may probably have impact origin. ... NGC 4513. ... The UV rings in isolated galaxies IC 522 and NGC 446 may represent the consequences of central impact by a satellite from a highly inclined...

Еще в разделе: (Показать все результаты (>49) - sn.sai.msu.ru/ )

• http://sn.sai.msu.ru/~sil/preprints/990399.ps.gz
• http://sn.sai.msu.ru/~sil/preprints/n7217_aa.ps.gz
• http://sn.sai.msu.ru/~sil/preprints/aj_leo2.pdf

... In vitro, the protein S7 of Thermus thermophilus is able to form complexes with both the minimal 16S rRNA fragment and the intercistronic region of the str operon mRNA from E.coli (Kd = 1.4x10-7 M and 1.1x10-7 M respectively). ... The filter binding assay. ... The most striking result of our study is that thermophilic protein S7 binds strongly to the E.coli S12-S7 intercistronic region of str mRNA in vitro, inspite of the lack of the functionally analogous thermophilic extended region. ...

Еще в разделе: (Показать все результаты (>6) - rnp-group.genebee.msu.ru/ )

• http://rnp-group.genebee.msu.ru/pages/pdf/nar2004.pdf
• http://rnp-group.genebee.msu.ru/pages/pdf/biochem2003.pdf
• http://rnp-group.genebee.msu.su/pdfs/article_vas_bioelectro.pdf

... Statutes of ERC . Methodical Commissions of ERC . ... The Methodical Commissions of the MSU Nanotechnology Education and Research Center (ERC) are set up according to all the research specializations of ERC. The Methodical Commissions of ERC are collegial bodies that prepare education programs of ERC and programs for developing courseware and training materials. ... ERC participants may be mutually agreed with members of methodical commissions representing relevant faculties and chairs. ...

Еще в разделе: (Показать все результаты (>15) - nano.msu.ru/ )