... Bat Research . Russian Bats . ... Here we are planning to arrange abstracts of Russian papers concerning bats, originally published mainly in poorly known local periodicals; also abstracts of foreign papers, which may be interesting to Russian bat specialists. ... Now you can find here only several abstracts of non-Russian articles (see "Abstract book"). In Russian version of this page you can also find several papers, mainly in Russian. ... Here one can find bat-related articles ? ...

Еще в разделе: (Показать все результаты (>1281) - zmmu.msu.ru/ )

• Index of /files/images/musei/publication
• Global fossil bat records - abstract
• A preliminary study on genetic divergence of the Asian lesser white-toothed

... Форумы > Разное > Тема . Автор темы Dr.Neurosurgus . Форумы Список тем Новая тема . ... Publication/Reference Managers . ... чем народ пользуется, чтобы не утонуть в базе ссылок по публикациям по своей теме? . не одними же Reference Manager и ProCite . ... http://forum.khamenya.ru . Ответить Цитировать . ... на сцайнтифике в general форуме . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>132) - www.mmonline.ru/ )

• До 1 ноября Springer предоставляет бесплатный доступ к более чем 150
• MMOnline | Форумы | Разное

... Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures is very young. We have grown up in the laboratory of laser spectroscopy of water media. ... Use of such powerful modern tools of solution of inverse problems and problems of optimization provides successful solution of a wide range of applied problems of diagnostics and analysis of water media. ... 2016 Laboratory of laser spectroscopy of solutions of supramolecular compounds and nanostructures . ...

Еще в разделе: (Показать все результаты (>33) - rswater.phys.msu.ru/ )

Moscow State University Belozersky Institute of Physico-Chemical Biology . Department of Electron Microscopy is a sub-division of A.N. Belozersky Institute of Physico-Chemical Biology . ... We are interested of how eukaryotic cell is organized, formed and functioned. Since A.N. Belozersky Institute of Physico-Chemical Biology is one of the scientific departments of Moscow State University ? ... Understanding the metaphase chromosome architecture remains a basic challenge in cell biology. ...

Еще в разделе: (Показать все результаты (>9) - cellbiol.genebee.msu.ru/ )

University Satellites and . Space Science Education . General information Date and Location Objectives of the meeting Sponsoring Organizations International Advisory Committee Local Organizing Committee Deadlines Addresses Hotels & Accommodation Venue Visas Social Programme . First circular . Second circular . ... Abstract Submission List of submitted abstracts . ... The list of abstracts submited . Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>6696) - cosmos.msu.ru/ )

Kluwer Academic Publishers, attn. Annelies Kersbergen, P.O. Box 17, 3300 AA Dordrecht, The Netherlands, Telephone: (0)78-6576215, Telefax (0)78-6576388 Consent to Publish & Transfer of Copyright | For the mutual benefit and protection of Authors and Publishers it is | ... written Consent to Publish and Transfer of Copyright before publication of the| Work. The signed Consent ensures | that the Publisher has the Author's permission to publish the relevant | Contribution. ...

Еще в разделе: (Показать все результаты (>105) - mgumus.chem.msu.ru/ )

• MGUMUS -- Researches
• MGUMUS -- Contacts
• MGUMUS -- Irina V. Perminova -- Photos

... RNA polymerase . ... DNA-directed RNA polymerase alpha(2), beta, beta-prime and omega subunits . Thermus aquaticus [TaxId: 271] . ... Thermus thermophilus [TaxId: 274] . ... Complete 12-subunit RNA polymerase II complex . Baker's yeast (Saccharomyces cerevisiae) [TaxId: 4932] . ...

Еще в разделе: (Показать все результаты (>51) - monkey.belozersky.msu.ru/ )

• S publications
• Homeodomain numeration assumed
• About authors ot this complex

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>240) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс
• Клуб выпускников МГУ: Обсуждение материала "Российские генетики расшифровали

New Series of Historical Publications from the MSU Press . In 1998, the History Faculty of Moscow State University inaugurated a new series of publications designed to promote the results of recent research efforts and the teaching experience of our Faculty members and Departments. It is our intention that with these editions a clearer understanding of the Faculty, its current research orientations and mission, may be communicated. ... New Series of Editions . ...

Еще в разделе: (Показать все результаты (>10) - www.hist.msu.ru/ )

• Editions

... Khmelev D.V. Reconstruction of linear index expressions for reducing programs to a linear class//Zhurnal Vychislitel'noi Matematiki i Matematicheskoi Fiziki. ... Khmelev D.V. Limiting theorems for asymmetrical transportation networks//Fundamental and Applied mathematics, 2001, vol.7, no.4, pp. ... Khmelev D.V. Markov chains and classification of text passages. (in Russian) [Raspoznavaniye avtora teksta s ispol'zovaniyem cepei A.A. Markova] Vestnik MGU, Ser.9:Philologiya, No 2, 2000, pp. ...

Еще в разделе: (Показать все результаты (>35) - old.philol.msu.ru/ )

• Our publications

P.V.Korolenko, N.N.Fedotov, V.F.Sharkov. Main properties and potential practical applications of M-mode lasers. ... T.I.Arsenyan, P.V.Korolenko, E.A.Kuliagina, N.N.Fedotov. ... T.I.Arsenyan, N.N.Fedotov, L.S.Kornienko, P.V.Korolenko, E.A.Kulyagina, G.V.Petrova Laser beams with helical wavefront dislocations and their applications in the diagnostical and metrological systems. // 5-th International Conference "Industrial Lasers and Laser Applications '95" (Shatura, Moscow reg., ...

Еще в разделе: (Показать все результаты (>4) - optics.sinp.msu.ru/ )

O.A. Aktsipetrov, E.A. Gan'shina, V.S. Guschin, T.V. Misuryaev, T.V. Murzina. Magneto-induced second harmonic generation and magneto-optical Kerr effect in Co-Cu granular films. ... A.A. Fedyanin, T.V. Misuryaev, T.V. Murzina, and O.A. Aktsipetrov. ... O.A. Aktsipetrov, A.V. Melnikov, T.V. Murzina, A.A. Nikulin, A.N. Rubtsov DC-electric-field-induced optical second harmonic generation at the smooth metal-electrolyte interface // Surf. ...

Еще в разделе: (Показать все результаты (>24) - shg.phys.msu.ru/ )

• All Publications Info Pad
• Publications Keywords Search
• List of Publications

... Search for Single Top Quark Production at DZero using Neural Networks" . ... Search for Single Top Quark Production at D0 Using Neural Networks" . ... Search for Electroweak Production of Single Top Quarks" . ... Use of Neural Networks in a Search for Single Top Quark Production at D0", . ... Search for Single Top Quark Production at the Tevatron" . ... Use of Neural Networks in a Search for Single Top Quark Production with the DZero Detector at the Fermilab Tevatron Collider", . ...

Еще в разделе: (Показать все результаты (>9) - top.sinp.msu.ru/ )

• Lev V. Dudko Home Page

... О факультете . Структура факультета . ... Научная работа . ... Коллеги, у Вас есть возможность публиковать научные статьи в Peer-Reviewed Open Access Journals: . Журнал ?Международные научные публикации: Экология и Безопасность (ISP:ES), Том 5, ISSN: 1313-2563 . Журнал ?Международные научные публикации: Материалы, Методы и Технологии (ISP:MMT), Том 5, ISSN: 1313-2539 . ... Д 501.001.20 - все защиты . ... все защиты ? ... Биологический факультет МГУ . ... 2016 Биологический факультет . ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

• Master In Ecology ? Биологический факультет МГУ

2000 . Charkin D.O., Berdonosov P.S., Dolgikh V.A., Lightfoot P. New oxochlorides of REE -silver with the LaOAgS structure type. ... T.V.Serov, R.Ya.Zakirov, M.L.Kovba, E.I.Ardashnikova, V.A.Dolgikh, M.E.Omari, I.M. Reau New anion-conducting solid solution in the NaF-MF 3 -M 2 O 3 (M = Nd, Bi) systems. ... P.S.Berdonosov, S.Yu.Stefanovich, V.A.Dolgikh A new bismuth-selenium oxychloride BiSeO 3 Cl: crystal structure and dielectric and nonlinear optical properties. ...

Еще в разделе: (Показать все результаты (>41) - www.inorg.chem.msu.ru/ )

• Prof. Dolgikh group. Publications 2001
• Prof. Dolgikh group. Publications 2002
• Prof. Dolgikh group. Publications 2003

... Smurova KM, Alieva IB, Vorob'ev IA. Free and centrosome-attached microtubules: quantitative analysis and themodeling of two-component system. ... Genes Cells. ... Mimori-Kiyosue Y, Grigoriev I, Lansbergen G, Sasaki H, Matsui C, Severin F, Galjart N, Grosveld F, Vorobjev I, Tsukita S, Akhmanova A. CLASP1 and CLASP2 bind to EB1 and regulate microtubule plus-end dynamics at the cell cortex. J Cell Biol. ... Cell Biol Int. 2004;28(2):139-50. ... Membr Cell Biol. 1997;11(2):195-211. in Russian . ...

Еще в разделе: (Показать все результаты (>34) - cellmotility.genebee.msu.ru/ )

• publications2
• Cell Motility Lab

.

Еще в разделе: (Показать все результаты (>4) - lab110.imec.msu.ru/ )

... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>98) - mccmb.belozersky.msu.ru/ )

• MCCMB'15 - OpenConf Peer Review & Conference Management System

... Issues of the year 2010 . ... Instructions for Authors . ... The scientific English language journal ‘GEOGRAPHY, ENVIRONMENT, SUSTAINABILITY’ aims at informing and covering the results of research and global achievements in the sphere of geography, environmental conservation and sustainable development in the changing world. ... In the text the surname of the author and the year of publication of the reference should be given in square brackets, i.e. [Author1, Author2, 2008]. ...

Еще в разделе: (Показать все результаты (>205) - www.geogr.msu.ru/ )

• ПУБЛИКАЦИИ В PEER-REVIEWED OPEN ACCESS JOURNALS OF INTERNATIONAL SCIENTIFIC

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search