... In particular spectral distributions of single counts and coincidence for pure biphoton states generated by a train of short pump pulses have been measured and the entanglement quantifier has been calculated. ... Considering that the pulse duration of the pump did not change we can observe that in this case the pump is 2.8 times greater than the coincidence spectrum whereas the single counts distribution is 64 times larger than the width of the pump. ... Phys. Rev. Lett., ... Phys., 9 (2006) S467. ...

Еще в разделе: (Показать все результаты (>86) - qi.phys.msu.ru/ )

• Publications :: Quantum Information Laboratory

FEATURES OF THE HYDROGEN DISTRIBUTION AROUND LUNAR CRATERS PROCLUS AND KEPLER. ... In result of analysis of the data Lawrence and Feldman constructed the hydrogen distribution on the lunar surface [1]. ... However, the authors shown, that EN flux data features may be explained by other element abundance in the lunar soils, namely: Si, Ca, Gadolinium (Gd), Samarium (Sm) and Fe. ... Using of the Feldman's interpretation of the Lunar Prospector data [8], we constructed hydrogen distribution map (Fig.1). ...

Еще в разделе: (Показать все результаты (>69) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Greg/Publications/ms38/ms067.pdf
• http://selena.sai.msu.ru/Shev/Publications/ms34/MS065.pdf
• http://selena.sai.msu.ru/Pug/Publications/SSR447.pdf

... All contacts alignment . ... Blue background means a contact with backbone phosphate. ... HBond with major groove + contact through a molecule of water with backbone phosphate; . ... contacts through water molecules both with backbone phosphate and major groove; . ... HBond with major groove + contacts through water molecules both with backbone phosphate and major groove; . ... HBond with major groove + engagement in hydrophobic cluster + contact through a molecule of water with backbone phosphate; ...

Еще в разделе: (Показать все результаты (>8) - monkey.belozersky.msu.ru/ )

• SDPpred

... Applying the sine-rule r r v1 v 2 = in this figure, gives: sin ( - ) = (m1/m2) sin sin sin ( - ) With sin ( - ) = sin cos - cos sin we get: m1 + cos m2 For m2 >>m1: tg = sin = sin 1 + cos µ with µ = m m 2 1 2 (2.10) Fig. ... Vector diagram for the derivation of the kinematic elations. - scattering angle in laboratory system (ls); - scattering angle in cm system (cms); - recoil angle cms; - recoil angle ls . ... The recoil angle (ls) as a function of the scattering angle (ls) for different values of ...

Еще в разделе: (Показать все результаты (>75) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/pci2012/vecher29_stend.pdf
• http://danp.sinp.msu.ru/LIIWM/nature446_07_627-s1.pdf
• http://danp.sinp.msu.ru/LIIWM/Mashkova_NIMBInPress_ErosionC-Fiber.pdf

... Outflows, proceeding during decades result to formation of oil secondary deposits. In a near-surface zone, oil pollution becomes especially chemically active and reacts with geological environment, that results in the anomalies of various geophysical methods: SP, IP, GPR and resistivity. ... The DAS, AM AMN algorithm of median polishing was offered by J.W.Tukey (1981), Rmin ABmin and after modification made by E.V.Pervago was applied for proc5 essing of Total Electrical Sounding (TES) data. ...

Еще в разделе: (Показать все результаты (>56) - geophys.geol.msu.ru/ )

• http://geophys.geol.msu.ru/shevnin/publ/171.PDF
• http://geophys.geol.msu.ru/shevnin/publ/176.pdf
• http://geophys.geol.msu.ru/shevnin/publ/187.pdf

... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...

Еще в разделе: (Показать все результаты (>28) - curl.sai.msu.ru/ )

• http://curl.sai.msu.ru/mass/download/doc/dimm_soft_description.pdf
• http://curl.sai.msu.ru/mass/download/doc/pmt_param_eng.pdf
• ASM Station

... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral­ time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...

Еще в разделе: (Показать все результаты (>36) - acoustics.phys.msu.ru/ )

University Satellites and . Space Science Education . ... Abstract Submission List of submitted abstracts . Registration List of registred participants . ... LINK=http://freeazn.110mb.com/100-background-check-free.html]100 background check free[/LINK] . ... The list of abstracts submited . Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...

Еще в разделе: (Показать все результаты (>33) - cosmos.msu.ru/ )

• UNIVERSAT-2009: University Satellites in Space Sciences Education, Zvenigorod,

... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......

Еще в разделе: (Показать все результаты (>35) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/matorin/3407.pdf
• http://library.biophys.msu.ru/matorin/3379.pdf
• http://library.biophys.msu.ru/matorin/3414.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

115. http://lizard.phys.msu.su/home/science/redistr-sst99.pdf

116. Author Timeline

117. Converter of Measurement Units

118. SDPpred

119. SWX - Главная

120. Hopping in Quasi-One-Dimensional Disordered Solids: Beyond the Nearest-Neighbor