Current Issue About us Editors Board of Editors Guidelines Contacts . ... 2015 . ... Submit your article . ... The article analyzes the research on a problem of effective functioning of the student s trade-union organizations. The author provides recommendations on management of the main lines of development of activity of the trade-union organizations of students. ... Trade-union organization, student trade-union organization, control system. ... Public Administrarion". ...
... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...
... It brought about the necessity for finding new methods of teaching literature to students of modern languages and new ways of forming their philological competence and developing their philological background knowledge. Key words: linguistic education, imaginative literature, philological competence, philological background knowledge, federal standards in linguistic education. ... 2004. ... 1999; Kukurian I. An Outline of English Literature (Against British Historical and Cultural Background). ...
[
Текст
]
Ссылки http://www.ffl.msu.ru/research/vestnik/4-2012-polubichenko.pdf -- 233.1 Кб -- 02.02.2013
[
Текст
]
Ссылки http://ffl.msu.ru/research/vestnik/4-2012-polubichenko.pdf -- 233.1 Кб -- 25.02.2013 Похожие документы
ДД PROCEEDINGS OF THE 31st ICRC, LODZ 2009 1 Preliminary Proton and Helium Spectra from the CREAM-III Flight Y. S. Yoon , H. S. Ahn , T. Anderson, L. Barbier?, ... Keywords: CREAM; energy spectra; protons and helium nuclei I . ... CREAM-III I N S T RU M E N T A N D F LIGHT The CREAM-III instrument consisted of a tungsten/scintillating fiber calorimeter, a dual layer Silicon Charge Detector (SCD), a Cherenkov Camera (CherCam), a Cherenkov Detector, and a Timing Charge Detector (TCD). ...
... In particular spectral distributions of single counts and coincidence for pure biphoton states generated by a train of short pump pulses have been measured and the entanglement quantifier has been calculated. ... Considering that the pulse duration of the pump did not change we can observe that in this case the pump is 2.8 times greater than the coincidence spectrum whereas the single counts distribution is 64 times larger than the width of the pump. ... Phys. Rev. Lett., ... Phys., 9 (2006) S467. ...
FEATURES OF THE HYDROGEN DISTRIBUTION AROUND LUNAR CRATERS PROCLUS AND KEPLER. ... In result of analysis of the data Lawrence and Feldman constructed the hydrogen distribution on the lunar surface [1]. ... However, the authors shown, that EN flux data features may be explained by other element abundance in the lunar soils, namely: Si, Ca, Gadolinium (Gd), Samarium (Sm) and Fe. ... Using of the Feldman's interpretation of the Lunar Prospector data [8], we constructed hydrogen distribution map (Fig.1). ...
[
Текст
]
Ссылки http://selena.sai.msu.ru/Shev/Publications/m44_76_sinitsin_shevchenko.pdf -- 164.0 Кб -- 16.03.2011 Похожие документы
... All contacts alignment . ... Blue background means a contact with backbone phosphate. ... HBond with major groove + contact through a molecule of water with backbone phosphate; . ... contacts through water molecules both with backbone phosphate and major groove; . ... HBond with major groove + contacts through water molecules both with backbone phosphate and major groove; . ... HBond with major groove + engagement in hydrophobic cluster + contact through a molecule of water with backbone phosphate; ...
... Applying the sine-rule r r v1 v 2 = in this figure, gives: sin ( - ) = (m1/m2) sin sin sin ( - ) With sin ( - ) = sin cos - cos sin we get: m1 + cos m2 For m2 >>m1: tg = sin = sin 1 + cos µ with µ = m m 2 1 2 (2.10) Fig. ... Vector diagram for the derivation of the kinematic elations. - scattering angle in laboratory system (ls); - scattering angle in cm system (cms); - recoil angle cms; - recoil angle ls . ... The recoil angle (ls) as a function of the scattering angle (ls) for different values of ...
... Outflows, proceeding during decades result to formation of oil secondary deposits. In a near-surface zone, oil pollution becomes especially chemically active and reacts with geological environment, that results in the anomalies of various geophysical methods: SP, IP, GPR and resistivity. ... The DAS, AM AMN algorithm of median polishing was offered by J.W.Tukey (1981), Rmin ABmin and after modification made by E.V.Pervago was applied for proc5 essing of Total Electrical Sounding (TES) data. ...
... Reports on progress and error are always recorded in the log file of the program. ... UT date of the measurement finish in YYYY-MM-DD format UT time of the measurement finish in hh:mm:ss format Average flux in A aperture Average flux in B aperture Average flux in C aperture Average flux in D aperture Normalized variance of flux in A aperture Normalized variance of flux in B aperture Normalized variance of flux in C aperture Normalized variance of flux in D ...
... OCEAN ACOUSTICS. ... It is proposed to use high frequency resolution methods of sonographic analysis (spectral time representation) of projections of the acoustic power flux vector for spatial resolution of sources that pro vide a higher signal to noise level at the output of the processing system. ... The problem of obtaining an acoustic image is extremely difficult, since the required spatial source resolution at low frequencies is usually several times smaller than the acoustic wavelength. ...
[
Текст
]
Ссылки http://acoustics.phys.msu.su/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011
[
Текст
]
Ссылки http://acoustics.phys.msu.ru/teachers/gordienko_files/localization_eng.pdf -- 1389.8 Кб -- 21.10.2011 Похожие документы
University Satellites and . Space Science Education . ... Abstract Submission List of submitted abstracts . Registration List of registred participants . ... LINK=http://freeazn.110mb.com/100-background-check-free.html]100 background check free[/LINK] . ... The list of abstracts submited . Skobeltsyn Institute of Nuclear Physics, Moscow State University, 2005-2006 . ...
... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Home Search Collections Journals About Contact us My IOPscience On the problem of the spontaneous exchange-driven electron interwell re-population in semiconductor quantum wells This article has been downloaded from IOPscience. ... The wave function for an electron in the second well has a similar form. ... Now our goal is to prove that for any electron state with all electrons in one well one can build another state with electrons equally populating both wells, which is lower in energy. ...
... 1 October 2012б б б б б б Call for Papers Opens . 21 February 2013 б б б Abstract and Summary Deadline (extended) . ... Early March 2013б б б Program Committee Meeting . ... б б б б б б б б б б б б б б б б б б б б б б б б б б б б б б б to submit a paper) . Mid of April 2013б б б Advance Program Available . 15 May 2013б б б б б б б б б б Deadlines for Advance Registration, Hotel Reservation, . ... 18-22 June 2013б б б б ICONO/LAT: 2013, Moscow, Russia . ... Author timeline . ...
Sorry, Your browser does not support frames. To see context of this page you should update it. Sorry, Your browser does not support JavaScript. To see context of this page you should enable JavaScript or update browser.
... SDPpred is a tool for prediction of residues in protein sequences that determine functional differences between proteins, having same general biochemical function. ... Amino acid residues that determine differences in protein functional specificity and account for correct recognition of interaction partners, are usually thought to correspond to those positions of a protein multiple alignment, where the distribution of amino acids is closely associated with grouping of proteins by specificity. ...
Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...
... The theories of hopping transport in quasi-one-dimensional disordered organic solids with Gaussian distribution of localized state energies are generalized to account for distant-neighbor transitions. ... At lower temperatures, where the hopping range extends beyond second-nearest neighbors, C(T) is further decreased. The analytical results are in fair agreement with the results of Monte-Carlo simulation of one-dimensional variable-range hopping. ...