... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

A Pleistocene Climatic Record on the Basis of a Complete Loess-Paleosol Sequence in Central China . ... A complete climatic signal in the loess plateau of Central China was obtained by combining the loess-paleosol record from soil unit S0 until S15 of the Huangling section with that from unit S9 until loess unit L36 of the Jiacun section near Baoji. ... This suggests that the climatic signal retrieved from the soil-paleosol sequence in Central China reflects global long term climatic changes. ...

Еще в разделе: (Показать все результаты (>132) - www.fadr.msu.ru/ )

• ESSAY
• "EcoPhoto" - Order photo - CD
• Фотоархив "EcoPhoto" - Заказ фото - CD

Arshakian T. G., Stepanov R., Beck R., Krause M., Sokoloff D. Simulations of total and polarized emission in evolving galaxies: "spotty" magnetic structures, AN, {\bf 332}, N5, 524-536, 2011 . Magnetic fields in nearby, star-forming galaxies reveal large-scale patterns, as predicted by dynamo models, but also a variety of small-scale structures. ... Ключевые слова: magnetic fields - dynamo - galaxies: magnetic fields - galaxies: high-redshift ...

Еще в разделе: (Показать все результаты (>42) - srcc.msu.ru/ )

• D.Moss, R.Stepanov, T.G.Arshakian, R. Beck, M.Krause, D.Sokoloff, Multiscale
• Leading scientific fellow Sergey Piskarev Ph.D.
• V.I. Ivanov, M.K. Trubetskov Handbook of Conformal Mapping with Computer-Aided

Lomonosov Moscow State University . ... Academic Programs . Academic Board . International Cooperation . ... Academic Departments Programs . ... Bulletin of Moscow University . ... Contact Us . Phone Email Directory . ... Phone: (495) 734 03 22 . Fax: (495) 932 88 67 . ... Phone: (495) 932 99 15 . ... Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University: . ... 2000 - 2016 Faculty of Foreign Languages and Area Studies Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>96) - ffl.msu.ru/ )

• About Us

МГУ имени М.В.Ломоносова Русская версия . ... Отправить сообщение Посмотреть контакты . Delete from contacts . Add to сontacts . ... Московский государственный университет имени М.В.Ломоносова, Москва, Россия . ... Филиал МГУ имени М.В.Ломоносова в г. Севастополе, Севастополь, Россия . ... Московский государственный университет имени М.В.Ломоносова, Географический факультет, Москва, Россия . ... МГУ имени М.В. Ломоносова . ... 119991, г.Москва, Ленинские горы, д.1, Главное здание МГУ . ...

Еще в разделе: (Показать все результаты (>10650) - conf.msu.ru/ )

... Brown x26; Mussett The Inaccessible Earth 01 Introduction.pdf . ... Brown x26; Mussett The Inaccessible Earth 02 Chapter.pdf . ...

Еще в разделе: (Показать все результаты (>49) - ocean.phys.msu.ru/ )

• Index of /courses/geo/lectures-addons/
• Index of /courses/geo/lectures-addons-11/
• Index of /courses/geo/lectures-addons/02/

... О лаборатории . ... Состав лаборатории . ... Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 год) 219 (2016 год) 217 (2015 год) 215 (2015 год) 217 (2014 год) 215 (2014 год) 315 316 219 218 117 CAPTCHA . ...

Еще в разделе: (Показать все результаты (>55) - nanolab.phys.msu.ru/ )

• User account | Laboratory of Nanophotonics & Metamaterials
• Students can now use the homework download system and track their current

... About Some Class of the Invariant Solutions of Partial Differential Equations Set . ... In the present paper the method of using of partial differential equations set symmetries for construction of the solution, defined a vector field integral curve on integral manifold of the equations set is considered. ... The possibility of the one-parameter solutions along a vector field using for an integration of partial differential equations set with arbitrary boundary conditions is considered. ...

Еще в разделе: (Показать все результаты (>92) - acs366.phys.msu.su/ )

... Chair of Computer Methods of Physics . ... Create new account (active tab) . ... Spaces are allowed; punctuation is not allowed except for periods, hyphens, apostrophes, and underscores. E-mail address * . ... The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Department of Physics M.V. Lomonosov Moscow State University , Chair of Computer Methods of Physics , 2014 . ... Let us know ! ...

Еще в разделе: (Показать все результаты (>2) - cmp.phys.msu.ru/ )

... User account . Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. ... Language settings . Language . ... This account's default language for e-mails. ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>4) - hsmi.msu.ru/ )

• Compose tips | MSU Higher school of management and innovation

... UNИX . ... Conferences . Immutable Page . Comments . ... Attachments . More Actions: Raw Text Print View Render as Docbook Delete Cache ------------------------ Check Spelling Like Pages Local Site Map ------------------------ Rename Page Copy Page Delete Page ------------------------ My Pages Subscribe User ------------------------ Remove Spam Revert to this revision Package Pages Sync Pages ------------------------ Load Save SlideShow . ...

Еще в разделе: (Показать все результаты (>15) - uneex.cs.msu.su/ )

• ForkLanguage - UNИX
• FrBrGeorge - UNИX
• FrBrGeorge/NagiosMap - UNИX

... When embedded within a base document, a URL in its absolute form may contain a great deal of information which is already known from the context of that base document's retrieval, including the scheme, network location, and parts of the url-path. ... Introduction This document describes the syntax and semantics for "relative" Uniform Resource Locators (relative URLs): a compact representation of the location of a resource relative to an absolute base URL. ... 3.1) Base URL embedded in the | ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc2396.txt

SUPERVISOR program User Guide SV version 0.24 Kornilov V., Shatsky N., Voziakova O. March 22, 2004 1 Contents 1 Basic principles 2 Comp onent programs 3 Writing the scenaria 4 Editing the SV configuration file 5 Starting the system A Command list for the communication of the system Sup ervisor A.1 Commands acknowledgment . ... Initialization should b e done b efore scenario starts execution of measurements ­ i.e. b efore sending any commands implying the non-parked status of comp onents. ...

Еще в разделе: (Показать все результаты (>31) - curl.sai.msu.ru/ )

• Index of /pub/
• Index of /pub/mirror/
• Index of /pub/mirror/suse/

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:31 Sat , 04 Dec 2010 20:44:37 GMT darkhan [23:c74a9885bf04] * Automata.py ( modified ) * State.py ( modified ) Comment in English Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( modified ) State: readable comments Sat , 04 Dec 2010 20:32:41 GMT ...

Еще в разделе: (Показать все результаты (>784) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=bb4a79cc6b6e424a24496b907ff54ff51d63e1c8&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=749533cdfc67782471aea02a0e4a1859de8ef2bd&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=eef739e055f486b3e97b57881c2590e3cac98860&limit=100&mode=stop_on_copy

... RUBRRRIKA RUBRIKA Evolution of the Quantitative Measures of Quantum Information: on the Path to a Unified Theory of Quantum Information B. A. Grishanin and V. N. Zadkov Physics Faculty and International Laser Center, Moscow State University, Moscow, 119992 Russia e-mail: grishan@comsim1.phys.msu.su Received July 11, 2002 Abstract--The most general approaches to determining the quantitative measure of quantum information are analyzed based on physical content. ... with an arbitrary state | ...

Еще в разделе: (Показать все результаты (>60) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/PRA22309.pdf
• http://qilab.phys.msu.ru/papers/Laser-Phys-Lett-2004.pdf
• http://qilab.phys.msu.ru/papers/JCTE-2002-en.pdf

... The sixth book "The Poetry of Moscow University: from Lomonosov and up to…" . has been published. The Poetry of Moscow University: from Lomonosov and up to… " . ... The idea of the project is to collect verses of all the poets who studied or worked in Moscow University. ... The greatest part of the works hasn’t been republished since they first appeared at the end of the 18 th , 19 th or the beginning of the 20 th century. ... In November 2005 the first printed book of poetry was published. ...

Еще в разделе: (Показать все результаты (>9) - lcl.srcc.msu.ru/ )

... Роджер Пэнг (љ Roger Peng) на своем youtube-канале выложил видео 4х недель своего курса ?Computing for Data Analysis? Week 1 : . ... Data Types . ... Reading/Writing Data: Part 1 . ... The ?str? function . ... Writing Functions . ... The mapply function in R . ... Using the apply function in R . ... Plotting (base graphics) . ... Plotting with lattice . ... IBM SPSS Statistics 20 и AMOS: профессиональный статистический анализ данных Самые важные научные исследования последнего десятилетия. ...

Еще в разделе: (Показать все результаты (>4) - tukachev.flogiston.ru/ )

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>2) - genseq.fbb.msu.ru/ )

International Symposium Quasifission Process in Heavy Ion Reactions Messina (Italy) November 8-9, 2010 First Circular Chairman : Giorgio Giardina ( Messina ) Co-Chairman: Avazbek Nasirov (Dubna) Co-Chairman: Sara Pirrone (Catania) Scientific Secretary: Giuseppe Mandaglio ( Messina ), and Alessia Di Pietro (Catania) Local Organizing Committee: Giovanni Fazio ( Messina ), Giorgio Giardina ( Messina ), Giuseppe Mandaglio ( Messina ), Marina Manganaro ( ...

Еще в разделе: (Показать все результаты (>56) - phys.msu.ru/ )

• Title