... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>91) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>54) - sp.cs.msu.ru/ )

• DVM отладчик. Детальный дизайн. Часть 4

... The ICSU Grants Programme supports collaborative scientific initiatives of the ICSU "family" in order to promote international scientific and technological activities that contribute to the benefit and well-being of society. A major part of the ICSU Grants Programme money is derived from funds contributed by UNESCO and the US National Academy of Sciences, marking their support to strengthening the scientific work associated with their respective science programmes. ... Reporting Obligations . ...

Еще в разделе: (Показать все результаты (>74) - www.fadr.msu.ru/ )

• Online Registration
• Strategy for project-based activities

... Meteorology and Climatology . ... Departments . ... Department of Meteorology and Climatology . ... 1981-2005 – Honoured Scientist of the RSFSR, Doctor of Geographical Sciences, Professor Emeritus of the University of Moscow, Professor M.A. Petrsyants. ... Kislov A.V. (Climatology, The Theory of Climate Change), Doctor of Geography . ... Rivin G.S. (General Circulation of the Atmosphere, Numerical Methods), Doctor of Physics and Mathematics. ... Gushchina D.Y. (Synoptic Meteorology), PhD . ...

Еще в разделе: (Показать все результаты (>47) - eng.geogr.msu.ru/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...

Еще в разделе: (Показать все результаты (>21) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group

... WHAT WE EXPECT FROM STUDYING TIME . ... Temporology, or time research, is understood as an interdisciplinary branch of general systems theory, which deals with causes, forms and measurements of the World's dynamical variability. ... One suggests a hypothesis that there exist "generating flows" in the World – natural processes which create the World's variability and whose properties may be identified or put into correspondence with the properties usually ascribed to the time phenomenon. ...

Еще в разделе: (Показать все результаты (>443) - chronos.msu.ru/ )

• Laboratory-chair of causal mechanics
• Laboratory-chair "Time as a phenomenon of the Universe expansion"
• LOGIC OF CAUSAL MECHANICS: OBSERVATIONS-THEORY-EXPERIMENTS

Team . Team has been working in the field of geoinformation technology more than 20 years. Members of the team have fundamental knowledge and experience both in modern information technology and in seismology. ... Information technology for developing of the map of maximum possible magnitudes (M max ) of expected earthquakes. Information technology for detection of earthquake precursors. ... The technology is supported by geoinformation system named Geo 2.5 . ...

Еще в разделе: (Показать все результаты (>224) - geo.web.ru/ )

• Asian Current Research on Fluid Inclusions (ACROFI III) International

Mathematical Modeling of Complex Information Processing Systems 93 DESIGN OF THE EAS CHERENKOV ARRAY FOR THE CERRA LA NEGRA SITE P. Bello 1 , G. K. Garipov 2 , B. A. Khrenov 2 , O. Martinez 1 , E. Moreno 1 , H. Salazar 1 , A. A. Silaev 2 , L. Villasenor 3 , and A. Zepeda 4 The design of the air Cherenkov detector array for the Cerra La Negra site (an elevation of 4 km) is presented. ... Statistics of the registered EAS depends on a sensitivity area \Sigma of the air Cherenkov array. ...

Еще в разделе: (Показать все результаты (>34) - num-anal.srcc.msu.ru/ )

День Физика . ... Новости . ... Абитуриентам . ... Главная Новости Наука . ... Новости сайта . ...

Еще в разделе: (Показать все результаты (>4) - www.dubinushka.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>150) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• About EMBnet

... Submitted by Маруся_П on Wed, 03/09/2016 - 16:07 . The paperљ Optical tweezers study of red blood cell aggregation andљdisaggregationљin plasma and protein solutions љwritten by Maria D.љKhokhlova,љEvgenyљV.љLyubin,љAndreyљA.љFedyaninљin collaboration withљKisungљLee,љMattiљKinnunen, Alexander V.љPriezzhevљand IgorљMeglinskiљ has just been published online љinљ The Journal of Biomedical Optics . ... Maxim Shcherbakov presents the nanophotonics on the Set Up Lectorium: . ...