... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>91) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU

DVM debugger - contents . Part 1 (1 - 4) . ... Writing to read-only variable is detected. ... Using non-initialized element <elem> . ... Using variable <var> before asynchronous reduction competed . ... The dynamic debugger detects access to a shadow element before asynchronous shadow renew competed . ... It is reported when any non-correspondence of trace or loop description file is detected. ... Different values of reduction operation are detected for current event and in reference trace record. ...

Еще в разделе: (Показать все результаты (>54) - sp.cs.msu.ru/ )

• DVM отладчик. Детальный дизайн. Часть 4

... The ICSU Grants Programme supports collaborative scientific initiatives of the ICSU "family" in order to promote international scientific and technological activities that contribute to the benefit and well-being of society. A major part of the ICSU Grants Programme money is derived from funds contributed by UNESCO and the US National Academy of Sciences, marking their support to strengthening the scientific work associated with their respective science programmes. ... Reporting Obligations . ...

Еще в разделе: (Показать все результаты (>74) - www.fadr.msu.ru/ )

• Online Registration
• Strategy for project-based activities

... Meteorology and Climatology . ... Departments . ... Department of Meteorology and Climatology . ... 1981-2005 – Honoured Scientist of the RSFSR, Doctor of Geographical Sciences, Professor Emeritus of the University of Moscow, Professor M.A. Petrsyants. ... Kislov A.V. (Climatology, The Theory of Climate Change), Doctor of Geography . ... Rivin G.S. (General Circulation of the Atmosphere, Numerical Methods), Doctor of Physics and Mathematics. ... Gushchina D.Y. (Synoptic Meteorology), PhD . ...

Еще в разделе: (Показать все результаты (>47) - eng.geogr.msu.ru/ )

... Студенческая Астрономическая обсерватория ГАИШ . ... Любителям астрономии . ... Структура ГАИШ : Отдел внегалактической астрономии : . ... The head of the group was born on October the 3rd, 1941 in the Yaroslavl' region of Russia and twenty-three years later graduated from the Faculty of Physics in the Moscow State University. ... 1989), Professor of astrophysics and stellar astronomy at the Faculty of Physics in MSU (1990). ... 2005, Astronomy Letters, 31 , 160 . ... chernin@sai.msu.ru . ... Staff ...

Еще в разделе: (Показать все результаты (>21) - www.sai.msu.ru/ )

• Отдел внегалактической астрономии: ГАИШ Extra-galactic astronomy Group

... WHAT WE EXPECT FROM STUDYING TIME . ... Temporology, or time research, is understood as an interdisciplinary branch of general systems theory, which deals with causes, forms and measurements of the World's dynamical variability. ... One suggests a hypothesis that there exist "generating flows" in the World – natural processes which create the World's variability and whose properties may be identified or put into correspondence with the properties usually ascribed to the time phenomenon. ...

Еще в разделе: (Показать все результаты (>443) - chronos.msu.ru/ )

• Laboratory-chair of causal mechanics
• Laboratory-chair "Time as a phenomenon of the Universe expansion"
• LOGIC OF CAUSAL MECHANICS: OBSERVATIONS-THEORY-EXPERIMENTS

Team . Team has been working in the field of geoinformation technology more than 20 years. Members of the team have fundamental knowledge and experience both in modern information technology and in seismology. ... Information technology for developing of the map of maximum possible magnitudes (M max ) of expected earthquakes. Information technology for detection of earthquake precursors. ... The technology is supported by geoinformation system named Geo 2.5 . ...

Еще в разделе: (Показать все результаты (>224) - geo.web.ru/ )

• Asian Current Research on Fluid Inclusions (ACROFI III) International

Mathematical Modeling of Complex Information Processing Systems 93 DESIGN OF THE EAS CHERENKOV ARRAY FOR THE CERRA LA NEGRA SITE P. Bello 1 , G. K. Garipov 2 , B. A. Khrenov 2 , O. Martinez 1 , E. Moreno 1 , H. Salazar 1 , A. A. Silaev 2 , L. Villasenor 3 , and A. Zepeda 4 The design of the air Cherenkov detector array for the Cerra La Negra site (an elevation of 4 km) is presented. ... Statistics of the registered EAS depends on a sensitivity area \Sigma of the air Cherenkov array. ...

Еще в разделе: (Показать все результаты (>34) - num-anal.srcc.msu.ru/ )

День Физика . ... Новости . ... Абитуриентам . ... Главная Новости Наука . ... Новости сайта . ...

Еще в разделе: (Показать все результаты (>4) - www.dubinushka.ru/ )

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>6) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast.out

... Why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ... BLAST (Basic Local Alignment Search Tool) is a set of similarity search programs designed to explore all of the available sequence databases regardless of whether the query is protein or DNA. ... Filters are used to remove low-complexity sequence because it can cause artifactual hits (please see Q: After running a search why do I see a string of "X"s (or "N"s) in my query sequence that I did not put there? ...

Еще в разделе: (Показать все результаты (>150) - www.genebee.msu.ru/ )

• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help
• About EMBnet

... Submitted by Маруся_П on Wed, 03/09/2016 - 16:07 . The paperљ Optical tweezers study of red blood cell aggregation andљdisaggregationљin plasma and protein solutions љwritten by Maria D.љKhokhlova,љEvgenyљV.љLyubin,љAndreyљA.љFedyaninљin collaboration withљKisungљLee,љMattiљKinnunen, Alexander V.љPriezzhevљand IgorљMeglinskiљ has just been published online љinљ The Journal of Biomedical Optics . ... Maxim Shcherbakov presents the nanophotonics on the Set Up Lectorium: . ...

Еще в разделе: (Показать все результаты (>101) - nanolab.phys.msu.ru/ )

• Our paper has been published in The Journal of Biomedical Optics | Laboratory
• Nanophotonics of surface states in photonic crystals | Laboratory of
• Optical tweezers and photonic force microscopy | Laboratory of Nanophotonics &

Proposals and projects in the Coordinated Call FP7-ICT-2011-EU- Russia Information Meeting Moscow: 21st October, 2010 EU- Russia Call · First ICT Joint Call with Russia (dedicated INCO Call in WP 11-12); joint calls have already been implemented in other areas of FP7 · Russia is investing in High Performance Computing: No 12 supercomputer in the top500 list is Russian; aiming to enter Top3 already in ...

Еще в разделе: (Показать все результаты (>54) - www.msu.ru/ )

• Faculty of Foreign Languages and Area Studies

... Наука . ... Ветер космических странствий . ... Thermonuclear power-station intended for receipt electrical energy in unlimited (on a large) scale on the basis cheap raw material-water. ... 5.Improved nuclear power-station on the basis U235, U238, Pu239 with great factor useful operations (efficiency)about 90% transformation of a thermal energy in an electricity. 6.Transference electrical energy without wires with great factor useful operations (efficiency) about 95%. ... Научная Сеть . ...

Еще в разделе: (Показать все результаты (>428) - www.nature.web.ru/ )

• Научная Сеть >> К полету готовы?
• Научная Сеть >> Меркурий ждет гостей
• Научная Сеть >> Снова о полете на Марс

Warning : oci_connect(): ORA-12543: TNS:destination host unreachable in / home / swx / public_html / models / sw_forecast.php on line 3 Warning : oci_parse() expects parameter 1 to be resource, boolean given in / home / swx / public_html / models / sw_forecast.php on line 4 Warning : oci_execute() expects parameter 1 to be resource, null given in / home / swx / public_html / models / ...

Еще в разделе: (Показать все результаты (>1230) - swx.sinp.msu.ru/ )

• http://swx.sinp.msu.ru/models/get_charea.php
• SWX - База данных событий СКЛ
• SWX - Главная

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>27) - seac47-2.phys.msu.ru/ )

... Рассказ о факультете . ... Семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching" . 1 октября на факультете состоялся научно-практический семинар "MSU and EF Research Collaboration Enhancing Language Learning and Teaching". ... Dr. Bernard Shearer, Head of English First in Russia (based in Moscow): Overview of English First and discussion of the different initiatives for teaching a variety of populations (young learners, teenagers, government, Olympics, etc.) ...

Еще в разделе: (Показать все результаты (>46) - ffl.msu.ru/ )

... Описание вакансии: . A postdoctoral position is currently available in Energy research group. ... The work will also involve catalyst characterisation and catalytic tests in high pressure fixed bed, autoclave reactors and high throughput unit with 16 parallel reactors. ... Candidate background: PhD in catalysis and chemical engineering. Experience with catalyst synthesis and laboratory catalytic reactors. ... следующая вакансия . список всех вакансий . добавить вакансию . ...

Еще в разделе: (Показать все результаты (>44) - www.chemport.ru/ )

• "Postdoc in France" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "PhD in France" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• прибор для измерения частиц на поверхности Surface Particle Guard SFG-20

Interaction of the relativistic laser pulse with the melted metal surface Larkin Alexey Annotation of the graduation work Investigation of high-energy particles generation and in particular generation of hard x-ray radiation and gamma radiation is an important and interesting problem of studying of high power laser-matter interaction. ...

Еще в разделе: (Показать все результаты (>201) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Rykovanov_Platonenko_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2010/Ivanov_Uryupina_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2016/Vais_Bochkarev_en.pdf

... 9) Oknyanskij V.L. 1994, "Optical-radio time delays in Q0957+561", Odessa Astronomical Publ., ... 11) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", in Proceedings of Int. Conf. ... 1994. 12) Oknyanskij V.L. 1994, "Connection between X-ray and optical variability in NGC4151", Astrophys. and Space Science, 222, p.157. ... 14) Oknyanskij V.L., van Groningen E., 1997, "Optical spectral variability of NGC4151 in 1990", Astronomical and Astrophys. ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

• Ilya Livshits Home Page
• Eugene Trunkovsky
• Irina Glushneva