... West European and American literature and culture of XIX-XX centuries, literature as discourse, reception studies, history of the book . ... Moscow: NLO, 2003. ... Moscow University Press, 1994. ... American Literature. ... Board Member, Administrative Board of Moscow University . Board Member, Administrative Board of the School of Philology, Moscow University . Board Member, Specialized Dissertation Board for West-European and Slavic Literatures, School of Philology, Moscow University . ...

Еще в разделе: (Показать все результаты (>249) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/new/main/people/kibrik-aa/cv.html
• Преподаватели кафедры германской и кельтской филологии

... Новости . ... Posted on October 25, 2011 by admin . ПОБЕДИТЕЛИ ОТБОРОЧНОГО ЭТАПА ПЕРВОГО ОНЛАЙН-ФЕСТИВАЛЯ ДРУЖБЫ ?РУССКИЙ ЯЗЫК ? ... Posted in Новости | Leave a comment . Posted on September 17, 2011 by admin . ... Posted on August 30, 2011 by admin . На сайте Фестиваля опубликованы электронные адреса вузов-соорганизаторов Фестиваля. Дополнения в списки будут вноситься по мере поступления заявок от учебных заведений, выразивших готовность стать соорганизаторами Фестиваля. ...

Еще в разделе: (Показать все результаты (>3) - friendship2011.cs.msu.ru/ )

• На сайте Фестиваля началась публикация работ участников. | Онлайн-фестиваль

... To save time, I will only provide ephemerides in 2000 coordinates. ... Note: most the orbital elements used to create these ephemerides were obtained from the International Astronomical Union Circulars (IAUCs), Minor Planet Circulars (MPCs) or the ICQ Comet Handbook. ... The following 1-day ephemeris (March 1, 1997 - October 1, 1997) is from Donald Yeomans of JPL and is based on Reference Orbit #55 (March 4, 1997). 2000 coordinates (March - September, 1997) [3/4/97] . ... Epoch: 1997 Feb. 1.0 . ...

Еще в разделе: (Показать все результаты (>10) - www.issp.ac.ru/ )

• International Science Olympiads
• Founding Statutes
• Comet Observation Home Page (Chernogolovka)

... Commission on Paleopedology . ... THE FIRST SCIENTIFIC DESCRIPTION OF EUROPEAN LOESS-PALEOSOL SEQUENCES - Alexander Makeev 08/3/2006 ( 0) . ... paleosol] Re: PalaeoPedology as a Commission - Dr.Stephen Nortcliff 27/11/2003 ( 0) . paleosol] Re: PalaeoPedology as a Commission - dan yaalon 26/11/2003 ( 0) . paleosol] Re: The future of the Paleopedogy Commission - Mermut 28/9/2003 ( 0) . ... Definition of paleosol and geosol; memo to John Catt - Roger Morrison 10/10/99 ( 1) . ...

Еще в разделе: (Показать все результаты (>3) - www.paleopedology.msu.ru/ )

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>81) - geophys.geol.msu.ru/ )

• Anis. Page2
• TRF_2d. Page 3.

МГУ имени М.В.Ломоносова Русская версия . ... Art Criticism and History . ... Economics . ... Associate Professor, PhD in Economics M. V. Artamonova . Associate Professor, PhD in History E. Y. Arkhipova . Associate Professor, PhD in Economics P. S. Kartaev . Associate Professor, PhD in Economics P. A. Kiriushin . Associate Professor, PhD in Economics E. A. Kozeltseva . Associate Professor, PhD in Economics A. A. Kramar . Associate Professor, PhD in Economics S. G. Makarova . ...

Еще в разделе: (Показать все результаты (>20) - conf.msu.ru/ )

FRANCO PERACCHI CURRICULUM VITAE ADDRESS Faculty of Economics Tor Vergata University via Columbia, 2 I-00133 Rome, Italy tel: +39 06 7259 5934 fax: +39 06 2040 219 e-mail: franco.peracchi@uniroma2.it CURRENT POSITION Professor of Econometrics, Tor Vergata University, 1997­. ... VISITING POSITIONS Princeton University, Fall 2006, Summer 2007, 2008 and 2009, Fall 2010. ... RAND Corporation P01 Project "Economic and health determinants of retirement behavior ", 2003­ 2008, coordinator Arie Kapteyn. ...

Еще в разделе: (Показать все результаты (>24) - www.mse-msu.ru/ )

• http://www.mse-msu.ru/images/Galbraith_trnslt.pdf
• http://www.mse-msu.ru/sc_pub/presman_sc_pub_2011.pdf

Introduction to condensed matter physics . ... Physics of semiconductors . ... Computers in experimental physics of semiconductors . ... Physics of semiconductor devices . ... The course deals with the main physical principles of functioning and design of various semiconductor devices. ... Techniques of semiconductor doping and methods of semiconductor parameters control. ... Experimental studies of energy spectra of various semiconductors by optical methods. ... Physics of Semiconductors division ...

Еще в разделе: (Показать все результаты (>41) - scon155.phys.msu.su/ )

• Ferroelectric phase transitions in IV-VI semiconductors associated with
• Irina A. Sluchinskaya

Administration of the Smolensk Region Smolensk University for Humanities Russian Association of Geomorphologists GEOMORPHIC PROCESSES AND GEOARCHAEOLOGY From Landscape Archaeology to Archaeotourism August 27-31, 2012 Moscow- Smolensk , Russia First Circular SCIENTIFIC PROGRAM SUPPORT Moscow St at e University International Association of Geomorphologists St at e Historical Conference venue: Smolensk University for Humanities (SHU) www.shu.ru. ...

Еще в разделе: (Показать все результаты (>259) - www.geogr.msu.ru/ )

• Instructions for Authors, contributing to “GEOGRAPHY, ENVIRONMENT,
• xuebr
• Общая и теоретическая география

... Форумы > Разное > Тема . Автор темы Sasha . Форумы Список тем Новая тема . 08.04.2007 08:45 . ... День Победы, год 2007. ... Со Знамени Победы все-таки убрали серп и молот . http://news.mail.ru/politics/1297266/comments/?page=2 . http://news.mail.ru/politics/1297266/comments/?thread=1C28A8C570A58833 . ... Следующая тема Предыдущая тема . ... Сайт работает с 29.08.2000, Copyright 2000 2011 MMOnline.Ru and MMForce.Net, . ...

Еще в разделе: (Показать все результаты (>198) - www.mmonline.ru/ )

• MMOnline | Форумы | Преподаватели | А.Т. Фоменко
• MMOnline | Форумы | Аспирантура | Аспирантская вакансия: байесовский анализ в
• MMOnline | Новости

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:53 Sat , 04 Dec 2010 21:16:12 GMT darkhan [24:e368337edc67] * Automata.py ( modified ) Correction in Automata Sat , 04 Dec 2010 20:44:37 GMT darkhan [23:c74a9885bf04] * Automata.py ( modified ) * State.py ( modified ) Comment in English Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( ...

Еще в разделе: (Показать все результаты (>174) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=24%3Ae368337edc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=c74a9885bf048a4938c290470e671c1c9c68dd33&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=23%3Ac74a9885bf04&limit=100&mode=stop_on_copy

. Events About Structure . President Vice-Presidents The Presidium The Board The Council . The President of Berberkov Kabardino-Balkarian State Univeristy, the Chairman of the Council of Rectors of the Kabardino-Balkaria Republic, The President of the Association for the Advancement of HEIs (The Association of Russian HEIs) . Back to the list . office@rsr-online.ru . 8 (495) 939-20-32

Еще в разделе: (Показать все результаты (>43) - www.rsr-online.ru/ )

• Structure
• RSR online
• GLYBOCHKO PETR VITALYEVICH

... Il etait une fois nous deux . ... salut . Et si tu n'existais pas . ... Et si tu n'existais pas Dis-moi pourquoi j'existerais Pour traоner dans un monde sans toi Sans espoir et sans regret Et si tu n'existais pas J'essaierais d'inventer l'amour Comme un peintre qui voit sous ses doigts Naоtre les couleurs du jour Et qui n'en revient pas Et si tu n'existais pas Dis-moi pour qui j'existerais Des passantes endormies dans mes bras Que je n'aimerais jamais Et si tu n'existais ...

Еще в разделе: (Показать все результаты (>6) - optics.sinp.msu.ru/ )

Научно-образовательный центр Геномного секвенирования МГУ . Научно-образовательный центр геномного секвенирования факультета биоинженерии и биоинформатики МГУ объявляет конкурс на поддержку проектов, использующих методыљ высокопроизводительного секвенированияљ (NGS) и проводимых исследователями (исследовательскими группами) МГУ.љ ... в МГУ имени М.В. Ломоносова, проводимый научно-образовательным центромљгеномного секвенирования факультета биоинженерии и биоинформатики МГУ,љпоступило 23 заявки.љ ...

Еще в разделе: (Показать все результаты (>3) - genseq.fbb.msu.ru/ )

• call - НОЦ геномного секвенирования ФББ МГУ

Supernova 2000K in MCG +9-19-191 This page is devoted to information on Supernova 2000K in MCG +9-19-191 Basic information on this SN, including the last reported brightness, on this Supernova can be found on the main page . Information on the original web pages for many of these images can be found on the Supernova links web page. MCG +9-19-191 is a galaxy 200" NNE of NGC 3888 . ... It was found to be a type Ia found 13 +/- 3 days past maximum light. ... Puckett image . ... Discovery mirror . ...

Еще в разделе: (Показать все результаты (>427) - www.rochesterastronomy.org/ )

• Supernova 2002bu in NGC 4242
• Supernova 2005da in UGC 11301
• Supernova 2002dv and 2002eg in UGC 11486

Modeling of single top tW+b signal at the LHC Slava Bunichev Moscow State University In collaboration with E. Boos and L. Dudko http://comphep.sinp.msu.ru Single top quark production at the LHC: leading order diagrams for single top production t-channel s-channel associated tW production Single Top tWb processes at the LHC: tWb channel gives a significant contribution to the Single Top signal at the LHC Discriminate single top tWb and tt-bar events 2. ...

Еще в разделе: (Показать все результаты (>81) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2013/tsirova_qfthep_2013-06-25.pdf
• http://qfthep.sinp.msu.ru/talks2015/Baskakov_QFTHEP_2015.pdf
• http://qfthep.sinp.msu.ru/talks/qfthep2010_berezhnoy.pdf

Optical determination of association constant of charge transfer complex of conjugated polymer Diploma thesis abstract of 6-year student Vlasov M.A. This work is dedicated to optical determination of association constant and extinction coefficient of charge transfer complexes (CTC) in donor-acceptor solution of polyparaphenylene-vinylene trinitrofluorenone. ... Absorbance spectrums of corresponding formation in solutions and films were analyzed as well. ...

Еще в разделе: (Показать все результаты (>70) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/about/staff/chesnokov_s_s/
• http://ofvp.phys.msu.ru/en/about/staff/morozov_v_b/
• http://ofvp.phys.msu.ru/en/about/staff/shkurinov_a_p/

... Next: Changing Image Resolution Up: Microscope Parameters Data Previous: Microscope Parameters Data Contents Index . Femtoscan and Nanoscope file formats have text headings, which can be viewed using menu command View/ Parameters.. ... It is possible to change the comments written in the file using menu command View/ Comment.. ... Next: Changing Image Resolution Up: Microscope Parameters Data Previous: Microscope Parameters Data Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>43) - www.spm.genebee.msu.ru/ )

• FemtoScan Online FAQs
• Olga's Main Page
• Instrument panel

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

? . Admission . Студентам . Аспирантам . Защиты диссертаций . Контакты . F.A.Q. Search . News . History . Русский . English . Карта сайта . Обратная связь . Username * . Password * . Request new password . Home . Заголовок . Автор . Введите полное название кафедры или имя автора . Tags . Категория: . Прочее . 8 January 2015 - 11:39 Автор: admin . Read more about ---- . Log in to post comments . ї 2016 Механико-математический факультет МГУ им. М.В. Ломоносова . О сайте .