... Il etait une fois nous deux . ... salut . Et si tu n'existais pas . ... Et si tu n'existais pas Dis-moi pourquoi j'existerais Pour traоner dans un monde sans toi Sans espoir et sans regret Et si tu n'existais pas J'essaierais d'inventer l'amour Comme un peintre qui voit sous ses doigts Naоtre les couleurs du jour Et qui n'en revient pas Et si tu n'existais pas Dis-moi pour qui j'existerais Des passantes endormies dans mes bras Que je n'aimerais jamais Et si tu n'existais ...

Еще в разделе: (Показать все результаты (>7) - optics.sinp.msu.ru/ )

Statistics in Morse theory of smo oth functions Vladimir I. Arnold Steklov Mathematical Institute, Moscow, Russia e-mail: arnold@mi.ras.ru There are exactly 17746 topologically distinct Morse functions with 4 saddles on the two dimensional sphere. This result basing on combinatorics of random graphs was obtained only two years ago within an investigation of Hilbert's 16th problem on topological classification of polynomials in real algebraic geometry. ...

Еще в разделе: (Показать все результаты (>22) - pont2008.cmc.msu.ru/ )

• Timetable of plenary lectures Международная конференция Дифференциальные

... Next: Changing Image Resolution Up: Microscope Parameters Data Previous: Microscope Parameters Data Contents Index . Femtoscan and Nanoscope file formats have text headings, which can be viewed using menu command View/ Parameters.. ... It is possible to change the comments written in the file using menu command View/ Comment.. ... Next: Changing Image Resolution Up: Microscope Parameters Data Previous: Microscope Parameters Data Contents Index Filonov 2005-02-04 ...

Еще в разделе: (Показать все результаты (>61) - www.spm.genebee.msu.ru/ )

• Connection to a Server
• Подключение к серверу
• FemtoScan Online FAQs

ChangeLog for / # # Generated by Trac 0.12.5 # 04/11/16 21:39:31 Sat , 04 Dec 2010 20:44:37 GMT darkhan [23:c74a9885bf04] * Automata.py ( modified ) * State.py ( modified ) Comment in English Sat , 04 Dec 2010 20:39:27 GMT darkhan [22:749533cdfc67] * State.py ( modified ) State: readable comments Sat , 04 Dec 2010 20:32:41 GMT ...

Еще в разделе: (Показать все результаты (>174) - kodomo.cmm.msu.su/ )

• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=24%3Ae368337edc67&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=e368337edc67a64345dbabaec274e4f7ec7f2d42&limit=100&mode=stop_on_copy
• http://kodomo.cmm.msu.su/trac/cca/log/?format=changelog&rev=23%3Ac74a9885bf04&limit=100&mode=stop_on_copy

Клуб выпускников МГУ (Московский Государственный Университет) . Новости культурной, политической и бизнес жизни США и Канады. ... По данным Бюро Статистики Труда\Bureau of Labor Statistics, за последние 30 лет занятость среди американцев 65 лет и старше увеличилась на 101%, и в ближайшие годы на рынке труда прогнозируется дельнейший рост доли пожилых людей. Подробнее . ... 19.04.2008 Иммигрировать в Канаду стало проще и быстрее . ... 18.04.2008 Постоянные карты проживания в Канаде . ...

Еще в разделе: (Показать все результаты (>361) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Канада инвестирует 1 млрд $ в систему контроля
• Клуб выпускников МГУ: Обсуждение материала "Время работать"
• Клуб выпускников МГУ: Время работать

... List of all selected researchers by country of host institution (in alphabetical order within each country group): http :// erc.europa.eu / pdf / ERC _StG2010Results_All_by_Country. pdf Lists of selected researchers by domain (in alphabetical order): Social Sciences and Humanities: http :// erc.europa.eu / pdf / ERC _StG2010Results_SH. pdf Life Sciences: http :// erc.europa.eu / pdf / ERC _StG2010Results_LS ... Calls for proposals: published annually in summer with deadlines in autumn. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/Evaluation_panels.pdf
• http://ideas.msu.ru/docs/CSA_guide_2008.pdf

Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . Scandinavian Journal of Caring Sciences . Scandinavian Journal of Immunology . Scandinavian Journal of Medicine & Science in Sports . Scandinavian Journal of Psychology . Scandinavian Journal of Statistics . ... Social Anthropology . ... Social Science Japan Journal . Social Science Quarterly . Social Sciences . ... Научная Библиотека Физического факультета МГУ имени М. В. Ломоносова . ...

Еще в разделе: (Показать все результаты (>12) - wwwlib.phys.msu.ru/ )

• Библиотека физичеcкого факультета МГУ - Электронные ресурсы

... IM2, c (2222430 nt) initn: 382 init1: 382 opt : 402 Z-score: 427.8 bits : 96.2 E(75): 3.7e-20 banded Smith-Waterman score: 402; 64.1% identity (64.1% similar) in 234 nt overlap (68- 300 :1090800-1091033) 40 50 60 70 80 90 NC_000 TAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC-CGT :: : ::: :::: :: :: :: :: AE0094 AAGAGCCCGGCTTTTGCCCGGTCTAAAACGCCGGGCGAATAAGCGGGGGGCAAGTCTGGT 1090770 1090780 1090790 1090800 1090810 1090820 100 110 120 130 140 150 ...

Еще в разделе: (Показать все результаты (>4) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>2) - swx.sinp.msu.ru/ )

... Наши профессиональные области: прикладная статистика, анализ сигналов и контроль процессов биологической и физической природы, история, философия, религия и др. ... Прочие же антропометрические показатели автора крайне заурядны и не представляют абсолютно никакого исследовательского интереса. см. также: Внатуре Арийская генеалогия Мастера . ... CONAN-t - Integrated Computer Series for Frequency Analysis, Control and Automation over Processes in Industrial and Technical Applications . ... Download . ...

Еще в разделе: (Показать все результаты (>13) - www.protein.bio.msu.ru/ )

... A This result can be applied to a wide variety of data sets, including electricity bills1, street addresses, lengths of rivers, physical and mathematical constants, and processes described by power laws. ... Based on the plausible4 assumption that people who make up figures tend to distribute5 their digits fairly uniformly, a simple comparison of first-digit frequency distribution from the data with the expected distribution according to Benford's law had to show up any anomalous results. ...

Еще в разделе: (Показать все результаты (>22) - www.eng.math.msu.su/ )