W elcome to LHE guests page . ... 1) Enter metro station, buy a metro ticket in the ticket-office if You have not it yet. ... You will find a table with the prices near the ticket-office. ... 1) Buy a bus ticket in a kiosk near the bus stop if You have not it yet. ... It is possible to buy a ticket for 1 trip from the bus driver (28 rub). 2) Enter a bus through the front door, stick your ticket into a machine near the turnstile and take it. ... You can find more information on this site . ...
... Geography of World Economy . ... Cryolithology and Glaciology . ... Departments . ... Research laboratories . ... Field stations . ... Type of field courses . ... Department of Cryolithology and Glaciology The Department was founded in 1945 with the name Department of northern countries . ... Our students are active members of PYRN (Permafrost Young Researchers Network), in which they share best practices, information about conferences, field courses, jobs. ... ISBN 5-89176-095-9 . ...
... Институт русского языка и культуры - учебное подразделение љ МГУ имени М.В.Ломоносова , которое занимается преподаванием русского языка как иностранного и неродного,љподготовкой иностранных граждан к обучению на профильных факультетах МГУ и в других высших учебных заведениях России, повышением квалификации и переподготовкой специалистов по профилю РКИ, тестированием, а также распространением и продвижением русского языка во всем мире. ... Институт русского языка и культуры МГУ имени М. В. Ломоносова...
hpc@cmc . Высокопроизводительные вычисления на ВМК МГУ . Blue Gene/P . ... Регистрация . ... Серия Blue Gene в мире . ... Доступ по SSH . ... Регламент доступа . ... С 2008 года на факультете ВМК МГУ имени М. В. Ломоносова работает суперкомпьютер IBM Blue Gene/P, который является одной из первых систем данной серии среди установленных в мире. Архитектура Blue Gene была предложена компанией IBM в рамках проекта по исследованию возможностей достижения новых рубежей в супервычислениях. ...
ELENA ROVENSKAYA RUSSIAN . ... Optimization and optimal control, dynamic systems, mathematical modeling in economics and ecology . ... Elena Rovenskaya's research aims at the theoretical elaboration of new methods for solving optimal control problems (both analytical and numerical), as well as at application of existing methods to solve economic, social and ecological problems. ... 2009) Rovenskaya E.A. To the Solution of an Optimal Control Problem with State Constraints by Doubled-variations Method. ...
... PHYSICS AND METAPHYSICS OF SPACE-TIME”. ... Turygin, "Theory of Direct Interparticle Interaction", Moscow, Energoatomizdat, 1986; Yu.S. Vladimirov, "Dimension of Physical Space-Time and Unification of Interactions", Moscow University Press, 1987; Yu.S. Vladimirov, "Space-Time: Evident and Hidden Dimensions, Moscow, Nauka, 1989; Yu.I. Kulakov, Yu.S. Vladimirov and A.V. Karnaukhov, "Introduction to Physical Structures Theory and Binary Geometrophysics", Moscow, Archimedes, 1992). ...
pic] [pic] PARTNERSHIP AGREEMENT between the Russian Rectors' Union and the Russia Machine Builders' Union The Russian Rectors' Union (RRU) and the Russian Machine Builders' Union (RMBU), hereinafter referred to as The Parties Confirming the importance of the further development and strengthening of partnership relations between the scientific-educational ...
... Angewandte Chemie International . Chemical Physics Express . ... HYLE - An International Journal for the Philosophy of Chemistry . ... Journal of Molecular Modeling . ... Journal of Vacuum Science & Technology . Polarization Spectroscopy of ordered systems (PSOS Newsletters). PBMRT - Bio/Chemical Journals and Newsletters . Protein Science . Chemical Physics Preprint Database . The Journal of Physical Chemistry . ... Journal of Chemical Information and Computer Science . ...
... PHP 4.0 features an automatic build system that's very flexible. ... The default config.m4 . dnl $Id: Extending_Zend_ Build .xml,v 1.1 2002/01/09 12:16:30 derick Exp $ dnl config.m4 for extension my_module dnl don't forget to call PHP_EXTENSION( my_module ) dnl If your extension references something external, use with: PHP_ARG_WITH( my_module , for my_module support, dnl Make sure that the comment is aligned: [ --with-my_module Include my_module support]) dnl Otherwise ...
... Irakli Sikharulidze . ... Admitted to the Moscow State University, Department of Physics . ... Admitted to the Russian-German Institute of Science and Culture (RGI) . 1998. B.S. from Moscow State University (physics of polymers) . Since 1998. MS course at the Moscow State University, Department of Physics, Chair of Polymer and Crystal Physics (Head Professor Alexei R. Khokhlov) . 1999. ... Group Physics of Macromolecules (Head Professor J?rgen P. Rabe) . ... I. Sikharulidze. ...
... Lomonosov Moscow State University . ... Home About Communication and Information Department . ... Our main areas of expertise are information exchange, building network partnerships, development of complex internet applications and solutions, implementing e-learning practices.б . ... Dr. of Science (biology) Alexander O. Makeev Graduated from Geographic Faculty of Lomonosov Moscow State University. ... Alexander Ladygin graduated from department of Biology of Lomonosov Moscow State University. ...
Developer Notes To Build Your Own Custom GUI Job Submission Run Applications for PC-GAMESS / Firefly Input Files Upon Existing Bourne Shell Scripts And Open Source Developer Tools Obviously the methodology below is not the only way to build graphical job submission run applications on Apple Macintosh computers but I found it fast and easy (and all of the necessary developer tools are open source). ... These applications were built with the developer tools, settings and configurations described above. ...
[
Текст
]
Ссылки http://classic.chem.msu.su/gran/gamess/macosx/DEVELOPER-NOTES-FIREFLY-GUI-RUN-APPS-MAC.pdf -- 213.4 Кб -- 23.02.2009 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
... MSU's HPC HISTORY . ... In 1956, Research Computing Center (RCC) of Moscow State University received its first computer тАЬStrelaтАЭ. ... BESM-6 computer was and still is considered to be of great importance to USSRтАЩs/RussiaтАЩs history of computer development. ... Same year RCC received its first BESM-6 computer, and despite its serial number 13 it proved to be lucky for the Center. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center ...
MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...
... Administrative problems: theory and practice . Dmitrieva N.I. The Impact of Logistics on Building Communications with Consumers and Business Partners . Gorobtsova A.V. Interactions Between Government and Society in Modern Russia (the results of a sociological study) . Kazmin M.A. Land Mortgage Development in Russia . ... Legal and political aspects of public administration . ... Communication management and strategic communication in public administration . ... Education management . ...
... Graduated in 1963 from the Faculty of Mechanics and Mathematics (Moscow State University). ... Honorary Doctor of Tokai University (Japan), Honorary Doctor of Istanbul University (Turkey), Honorary Doctor of Mongolian University , Honorary Doctor of Hanoi National University (Viet-Nam), Honorary Doctor of Byelorussian State University , Honorary Doctor of Yerevan University (Armenia), Honorary Doctor of Tashkent University (Uzbekistan), Honorary ...
... P hysics Faculty, Moscow State University, . ... Moscow State University, Physics Faculty, Diploma work in Hydrodynamics . ... Title: «Dynamical Stochasticity of Nonlinear Systems and a Prediction Problem» . ... The First International School-Conference BILLIARDS’09 – « Mathematics and Physics of Billiard-Like Systems », February 16-19, 2009, guas de Lindoia, SP, Brazil . ... Invited Lectures «Chaos in Dynamical Systems», The Space Research Institute, Russian Academy of Science, Moscow, Russia . ...
INFORMATION BULLETIN No.2 . ... XXI International Workshop . on High Energy Physics and Quantum Field Theory Repino, Saint Petersburg Area, Russia, . ... we inform you that the deadline for application for the XXI International Workshop on High Energy Physics and Quantum Field Theory (QFTHEP'2013) has been extended till April 30, 2013 . ... 1770 roubles (approx. 59 / EUR 45)/ night per person . ... You can find further information about the Workshop at our Web site http://qfthep.sinp.msu.ru . ...