THE PROBLEM OF COUNABILITY OF HIGHEST ORDINALS . ... The first form corresponds to the geometric representation of ordinal w n as an infinite n -dimensional matrix. According traditional formulation w w = U w i , i =1, w , thus w w is w -countable union of countable ordinals so w w is countable. ... TWO METHODS OF RENUMBERING OF ELEMENTS OF ORDINALS The fist infinite ordinal w designates the set of natural numbers which is countable by definition. ... This matrix represents ordinal w (w ^ w) . ...

Еще в разделе: (Показать все результаты (>8) - www.protein.bio.msu.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>11) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

... 10, 63 ­ 64 (2010) / DOI 10.1002/pamm.201010024 Integrability and nonintegrability in terms of transcendental functions in dynamics of a rigid body Maxim V. Shamolin1, 1 Institute of Mechanics, Lomonosov Moscow State University, Michurinskii Ave., ... This circumstance allowed the author to perform a complete analysis of all phase trajectories and highlight those properties of them which exhibit the roughness and preserve for systems of a more general form. c 2010 Wiley-VCH Verlag GmbH & Co. ...

Еще в разделе: (Показать все результаты (>39) - shamolin2.imec.msu.ru/ )

• http://shamolin2.imec.msu.ru/art-185-2.pdf
• http://shamolin2.imec.msu.ru/art-160-1.pdf
• http://shamolin2.imec.msu.ru/art-136-1.pdf

... Consider a matrix S. The element sij of S is equal to the number of inextendible directed sequences from the minimal vertex i to the maximal vertex j . ... Therefore the number of directed sequences from the vertex i to the vertex j is equal to the element wij of a matrix W: N W= k =0 V k , (1 9 ) 6 where N is equal to the number of edges in the graph. ... Tr S is equal to the number of inextendible directed sequences from minimal vertexes to maximal vertexes that have equal numbers. ...

Еще в разделе: (Показать все результаты (>14) - temporology.bio.msu.ru/ )

• http://temporology.bio.msu.ru/EREPORTS/krugly_unfaithful.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_discreet-mechanics.pdf
• http://temporology.bio.msu.ru/EREPORTS/krugly_the-dinamics.pdf

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>9) - mph.cmc.msu.ru/ )

... Lectures : Nanomagnetism / Fundamentals I and II 1. a. b. c. d. 2. a. b. c. d. 3. a. b. c. d. e. Introduction Diamagnetism Paramagnetism Ferro-, Ferri- and Antiferromagnetism Magnetic susceptibility and permeability Magnetic order and magnetic interactions Magnetic exchange (direct, indirect, and superexchange) Dipolar magnetic interaction Spin-orbit interaction Local magnetic moments and spin-polarized electron band structure ...

Еще в разделе: (Показать все результаты (>24) - nano.msu.ru/ )

• Statute on the Methodical Commissions of the MSU Nanotechnology Education and

... What distinguishes Armenian from most other Indo-European languages is the unusually high proportion of early lexical borrowings. ... The first case is that of Urartean, a non-Indo-European language spoken during the first millennium BC in the mountains of Eastern Anatolia, roughly in the same area where Armenians lived up to 1915. ... The second one is the case of Parthian, an Indo-European Iranian language that was spoken in Northern Iran from around 300 BC to 300 AD. ...

Еще в разделе: (Показать все результаты (>16) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/refl-ucla.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/sippanti.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/palaic1.pdf

Vol 444|30 November 2006 NEWS & VIEWS ARCHAEOLOGY High tech from Ancient Greece FranГois Charette The Antikythera Mechanism, salvaged 100 years ago from an ancient shipwreck, was long known to be some sort of mechanical calendar. ... LIBRARY, LEIDEN STEM-CELL BIOLOGY A move in the right direction Jeffrey S. Chamberlain Stem-cell therapy is valued for its potential to restore damaged or degenerating tissues. ... Although a variety of stem-cell types can become muscle cells when injected into the ...

Еще в разделе: (Показать все результаты (>87) - hbar.phys.msu.ru/ )

• http://hbar.phys.msu.ru/gorm/ahist/antikythera1.pdf
• Historical Eclipses

... Correlative immunostaining with anti-tubulin antibodies and electron microscopy established that apparent free microtubules observed in vivo were not growing ends of long stable microtubules. ... A) Plus and minus ends of free MTs; (B) ends of long MTs. ... Minus ends of free MTs in PtK1 cells are stable The production of free minus ends of MTs in PtK1 cells has now been observed by three pathways: self-assembly in the cytoplasm, release from the centrosome (Keating et al., 1997) and breakage of MTs...

Еще в разделе: (Показать все результаты (>32) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Grigoriev_2006a_CMC.pdf
• http://cellmotility.genebee.msu.ru/html/articles/vorobjev2002CBI.pdf

... In particular spectral distributions of single counts and coincidence for pure biphoton states generated by a train of short pump pulses have been measured and the entanglement quantifier has been calculated. ... Considering that the pulse duration of the pump did not change we can observe that in this case the pump is 2.8 times greater than the coincidence spectrum whereas the single counts distribution is 64 times larger than the width of the pump. ... Phys. Rev. Lett., ... Phys., 9 (2006) S467. ...

Еще в разделе: (Показать все результаты (>84) - qi.phys.msu.ru/ )

• http://qi.phys.msu.su/papers/2008-pra-77-032336.pdf
• http://qi.phys.msu.su/papers/2006-jetp(e)-102-712.pdf
• http://qi.phys.msu.ru/papers/2013-njp-15-035012.pdf

... Phys. J. Special Topics 157, 223­238 (2008) c EDP Sciences, Springer-Verlag 2008 DOI: 10.1140/ep jst/e2008-00643-9 THE EUROPEAN PHYSICAL JOURNAL SPECIAL TOPICS Co evolutionary motion and swarming in a niche space mo del of ecological sp ecies interactions C.J. Dommar1 , a , A. Ryabov1,2 , and B. Blasius2 1 2 ,b Department of Physics, University of Potsdam, 14415 Potsdam, Germany ICBM, University of Oldenburg, 26111 Oldenburg, Germany Abstract. ... Evolutionary dynamics in a three species chain. ...

Еще в разделе: (Показать все результаты (>66) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/PDF/TMPh_quadratic_cml.PDF
• http://chaos.phys.msu.ru/prokhorov/phd/tmf_eng.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/JETP5_04Los_Dzh.pdf

... 2006 . ... Доктор Вульф также является профессором евразийской истории Центра славянских исследований Университета Хоккайдо в Саппоро (Япония), экс-директором Международного проекта по истории холодной войны в Вашингтоне, автором книги To the Harbin Station: The Liberal Alternative in Russian Manchuria, 1898 1914 (Stanford, 1999). ... E- mail: David.Wolff@nottingham.edu.cn . ... Wolff D. Open Jaw: A Harbin-centered View of the Siberian-Manchurian Intervention, 1917 22 // Russian History. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

... Ph.D., professor, Head of International Studies, School of International Studies, The Uiversity of Nottingham Ningbo, China. Dr. Wolff is also a professor at the Slavic-Eurasian Research Center at the University of Hokkaido in Sapporo (Japan) and director emeritus of the Cold War International History Project. ... Dr. Wolff s research focuses on the problems of Russian and Soviet emigration, Cold War, the history of Syberia and the Far East, and international relations. ... Issue 2 3. ...

Еще в разделе: (Показать все результаты (>172) - ee-journal.spa.msu.ru/ )

1, 120101 (2012) : . 119991, , , . ... Alternative core environmental mo dule for students : features of the foundations of ecology from the physics p ositions V. A. Gordienko 1 1,a , K. V. Pokazeev 2,b , M. V. Starkova 3,c 3 M. V. Lomonosov Moscow State University, Physical Faculty, Department of Acoustics. ... Keywords : ecology and environmental management, environmental education, a systematic approach to the ecology and current environmental problems, modeling and prediction in ecology. ...

Еще в разделе: (Показать все результаты (>3) - uzmu.phys.msu.ru/ )

... We also prove some a generalization of the Kauffman­Murasugi­Thistlethwaite theorem on "minimal diagrams" for graph-links. ... Virtual trefoil. ... Introduction to Graph-Link Theory 799 Conversely, having a connected virtual diagram K (with at least one classical crossing) with oriented atom, one can get a labeled chord diagram. ... We conjecture that the graph-link represented by BW3 has no "realizable" representatives which correspond to classical or virtual diagrams via chord diagrams. ...

Еще в разделе: (Показать все результаты (>38) - dfgm.math.msu.su/ )

• http://dfgm.math.msu.su/files/papers-sym/brahana.pdf

... О факультете . ... Master In Ecology . Master In Nanobiotechnology . ... Nanobiotechnology and Biophysics? is intended for prospective highly qualified professionals with in-depth knowledge in of modern biophysics, molecular biology and nanobiotechnology. ... The program is focused at problems of modern nanobiotechnology, biophysics and proteomics, and hence it consists of the two parts: lectures/seminars and laboratory work. ... Lectures / Practical . ... Биологический факультет МГУ . ...

Еще в разделе: (Показать все результаты (>5) - www.bio.msu.ru/ )

... The Early Pale oproterozoic gabbronorite dikes contain a secondary component of NRM that is pointed NNW with a strong positive slope that is correlated with the post orogenic collapse of 1.95­1.88 Ga B.P. Formation of the second alternating magnetization phase of rocks is estimated at 1.8­1.75 Ga B.P., which corresponds to the influence of post orogenic hydrothermal fluids. ... Negative folding and contact tests indicate the secondary nature of this high temperature magnetiza tion component. ...

Еще в разделе: (Показать все результаты (>19) - dynamo.geol.msu.ru/ )

• http://dynamo.geol.msu.ru/personal/vsz/papers/Koronovsky_etal_2015_eng.pdf

... Data . ... Solar energetic particles . ... Nucleon . ... Particle spectra at LEO . ... Overview ] [ Documentation ] [ SEP Events ] [ SEP Model ] . ... 1.2 High-energy heavy ions (Z = 6, 7, 8, 10, 12, 14, 16, and 26) by ACE spacecraft (SIS instrument) data are selected from: . ... The SEP events were selected by GOES-8 4th channel (15-40 MeV) data (see Fig.1). ... E тАУ ionтАЩs kinetic energy in MeV/nucl; Moc2 =938 MeV тАУ nucleon rest energy; †Я=v/c тАУ particleтАЩs relative velocity. ...

Еще в разделе: (Показать все результаты (>18) - smdc.sinp.msu.ru/ )

... Geophys., 24, 1957­1968, 2006 www.ann-geophys.net/24/1957/2006/ © European Geosciences Union 2006 Annales Geophysicae Alternating bursts of low energy ions and electrons near the substorm onset T. V. Kozelova1 , L. L. Lazutin2 , B. V. Kozelov1 , N. Meredith3 , and M. A. Danielides4 1 2 3 4 Polar Geophysical Institute ... Alternating bursts of low energy ions and electrons near the substorm onset Table 1. ... The ion bursts occurred 1­2 min before the electron (2.47­21.7 keV) bursts. ...

Еще в разделе: (Показать все результаты (>238) - www.kosmofizika.ru/ )

• Нейтроны и космическая погода, Кужевский и др.
• Science Technology: Ongoing Solar Activity

... The quantity of solar radiation received ... on a unit of surface in a unit of time is called the solar constant . ... At the time . ... Завершено решение задачи . Solution (the consideration) of the problem is completed . ... Закон арксинуса . Arcsine law . ... Geometric conservation law . ... The law of conservation and transformation of energy . ... Channel closing and opening . ... Замкнутое множество относительно операции сложения . ... Differ from ... in sign . ... Зона активная . ...

Еще в разделе: (Показать все результаты (>47) - num-anal.srcc.msu.ru/ )

• http://num-anal.srcc.msu.su/eng_math/redict/5.htm
• Поясняющие фразы
• БЧА НИВЦ МГУ. AMTSR_C. Транспонирование матриц