... Отдел культуры древности . ... 1988-1993 - обучение на филологическом факультете МГУ им. М. В. Ломоносова; диплом с отличием. 1993-1996 - аспирантура на филологическом факультете МГУ им. М. В. Ломоносова. 1994-1995 - лектор русского отделения факультета литературы и философии Istituto Universitario Orientale ( Napoli , Italia ). с 1996 по настоящее время - старший научный сотрудник Института истории мировой культуры ... Тарту, [2011]. - 1, 3 а.л. Институт мировой культуры МГУ 2003-2007 . ...
... What are mechanisms of secular evolution? ... Internal mechanisms of secular evolution may b e: · bar instabilities in dynamically cold disk galaxies , · deviations from circular rotation due to non-axisymmetric gravitation p otential effect which may b e produced by planar structures ... gravitational and energetic, effects of nuclear sup ermassive black holes they may provoke as attraction as well expansion, · certain gas expansion by galactic winds and fountains, etc ...
... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...
... Бережной А.А., Клумов Б.А., Фортов В.Е., Шевченко В.В. Письма в ЖЭТФ, Т. 63, N6, С. 387-391, 1996 . ... A. A. Berezhnoy1,2, N. Hasebe1, M. Kobayashi1, G. Michael3 and N. Yamashita1 1Advanced Research Institute for Science and Engineering, Waseda University, Tokyo, Japan 2Sternberg Astronomical Institute, Moscow, Russia 3German Aerospace Center, Institute for planetary research, Berlin, Germany . Brown University - Vernadsky Institute Microsymposium 40, 2004, Moscow, Russia . ...
... MITROFANOVA E-mail: mitrofanov@breitmeier.de GALTON BOARD Received October 1, 2003 DOI: 10.1070/RD2003v008n04ABEH000255 In this paper, we present results of simulations of a model of the Galton board for various degrees of elasticity of the ball-to-nail collision. ... The funnel is lo cated precisely ab ove the central nail of the second row, i. e. the ball, if p erfectly centered, would fall vertically and directly onto the upp ermost p oint of this nail's surface (Fig. ... Fig. ... MITROFANOVA Fig...
[
Текст
]
Ссылки http://ics.org.ru/upload/iblock/d40/126-galton-board_ru.pdf -- 2035.7 Кб -- 28.10.2015 Похожие документы
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
Please enter the lightcurve file name and period search parameters: . Lightcurve file: . ... Apply the Heliocentric correction and convert all dates to Terrestrial Time (TT)? ... Phase range for plots: -0.5 to 1.0 0.0 to 2.0 0.0 to 1.0 . ... Also, the Heliocentric correction cannot be applied to such lightcurves. ... Two period search methods are currently implemented. ... This period search service is also available at the mirror sites: Mirror 1 , Mirror 2 , Mirror 3 , Mirror 4 . ...
... О факультете . ... Heng Zhang, Lei Li, Martin M?ller, Xiaomin Zhu, Jaime J. Hernandez Rueda, Martin Rosenthal, and Dimitri A. Ivanov*// From Channel-Forming Ionic Liquid Crystals Exhibiting Humidity-Induced Phase Transitions to Nanostructured Ion-Conducting Polymer Membranes "// Advanced Materials 25 (2013) 3543-3548. ... МГУ имени М.В.Ломоносова; авторы Герасин В.А., Иванов Д.А., Антипов Е.М. , Князев Я.В., Антипова Л.А., Гусева М.А. Список статей, опубликованных членами трудового коллектива . ...
... jъ \Gamma p at 18 GeV=c. A large asymmetry in the angular distribution is observed indicating interfer ence between Leven and Lodd partial waves. ... 0:95 GeV 2 are shown in Fig. 3ac. Here, the acceptancecorrected numbers of events predicted by the PWA fit for the D+ and P+ waves and their phase difference \Delta\Phi(D + \Gamma P+ ) are shown as a function of M(jъ \Gamma ). ... GeV/c) 2 FIG. 1. a.) The jъ \Gamma effective mass distribution. b.) Distribution of jt 0 j = jtj \Gamma jtj min . ...
... структура порожденного им редуцированного процесса, распределение момента рождения ближайшего общего предка всех частиц, существующих в популяции в далекий момент ближайшим общим предком. n , а также тип частицы , являющейся March 19 A. V. Vatutin N ( Steklov Mathematical Institute) Macroscopic and microscopic structures of the decomposable critical branching process A decomp osable strongly critical Galton-Watson branching pro cess with typ es of ... Particles of island N do not...
[
Текст
]
Ссылки http://new.math.msu.su/department/probab/bsk_2014-03-19.pdf -- 210.9 Кб -- 18.03.2014 Похожие документы
... Продолжалась обработка данных эксперимента ZEUS на коллайдере HERA. ... By D0 Collaboration [arXiv:1011.1931] FERMILAB-PUB-10-446-E (Nov 2010) 10p. 2) A measurement of the ratio of inclusive cross sections $\sigma(p\bar{p}\rightarrow Z+b{\rm\, jet})/ \sigma(p\bar{p}\rightarrow Z+{\rm jet})$ at $\sqrt{s}=1.96$ TeV. ... ZEUS Collaboration (S. Chekanov et al.) ... By CMS Collaboration [arXiv:1010.4439] CMS-EXO-10-002 (Oct 2010) 3) Search for Dijet Resonances in 7 TeV pp Collisions at CMS. ...
astro-ph/0207226 . ... Comments: Astropart. Phys., in press, LaTex (elsart.cls included), 29 pages, 4 figures, also available at http://www.mpifr-bonn.mpg.de/staff/hfalcke/publications.html#lofarpaper . ... Comments: Invited talk presented at SPIE conf. on Infrared Spaceborne remote Sensing X, Seattle, July 2002, 13 pages, to be published in SPIE vol. ... Comments: 9 pages, 2 figures, to appear in the proceedings of the XXII Moriond Astrophysics Meeting (held in Les Arcs, 9-16 March 2002) . ...
С радостью сообщаем Вам, что 30-летний юбилей нашего курса состоится! И если перевести наш славный юбилей на химический язык (спасибо Мише Айзенбергу!), то получится, что праздновать мы будем День 47 Ag 17 Cl. ... В этот день для всех нас, кто окончил химический факультет в 1982 году, предполагается следующая программа: . ... Бадун Гена: каф. радиохимии, к. 217, 220, тел. (495)939-4793, e-mail: badunga@yandex.ru . ... Русняк (Конобас) Юля к. 357 тел: +7(916)161-4451, e-mail: juliya_rus@bk.ru . ...
... Исследование синхронности резких изменений альфа-активности ЭЭГ человека. ... Сегментация ЭЭГ без использования статистических подходов при поиске границ между сегментами . Почти во всех работах по адаптивной сегментации использовалось построения моделей ЭЭГ-сигнала в движущихся "окнах" с использованием интерактивного алгоритма. ... Были предприняты отдельные попытки проводить адаптивную сегментацию не только без использования окон, но и без построения каких-либо моделей. ...
... Вт Мар 31 11:57:41 MSD 2009 . Предыдущее сообщение: PARALLEL.RU - Новости, выпуск #261 [18/03/2009] . ... Детали будут объявлены дополнительно. http ://agora.guru.ru/parallel/ ------------- В издательстве Московского университета выпущена книга: Антонов А.С. Параллельное программирование с использованием технологии OpenMP: Учебное пособие . http :// parallel.ru /info/parallel/openmp/ ------------- ЧТО НОВОГО? http :// parallel.ru /about/whatsnew.html + В рамках совместного Центра МГУ- ...
Software on Data Processing . We Offer Statistical Software And . Software On Data Analysis And Processing. ... The package is intended for those, who doesn't have large experience in statistical analysis, but needs a quick and convenient data processing tool. ... Package provides full complex of registration and analysis methods, individual EKG monitor-analyzer, special tools for complete polygraph analysis. price: 700$ - 2200$. phone number (095) 437-3695, 155-1365 . ... InCo . ...