Open Conference Systems . Conference Help . ... Username . Password . Remember me . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... By Conference . By Author . By Title . ... For Authors . Home . ... Log In . Account . Search . Current Conferences . Home > Log In . ... Remember my username and password . ... Create an account with this site . Forgot your password? ...

Еще в разделе: (Показать все результаты (>61) - hea.phys.msu.su/ )

• Account

. Russian Version . Faculty of Computational Mathematics and Cybernetics . The Department of Operations Research . About Us . News . ORM2016: actual announcement and abstract templates . Archive of . Conferences ORM . Study . Undergraduates . Postgraduate education . Bachelor Program . Master Program . Faculty . Lecture . notes . Contacts . Graduates . New . publications . Create Date : 23.05.05 . The Department of Operations Research

Еще в разделе: (Показать все результаты (>21) - io.cmc.msu.ru/ )

• Кафедра Исследования Операций

Lomonosov project . ... Mikhail Lomonosov . Scientific goals . ... Scientific equipment . ... Please enter your username or email address. You will receive a link to create a new password via email. Username or E-mail: . ... Password . ... Lost Password . ...

Еще в разделе: (Показать все результаты (>41) - lomonosov.sinp.msu.ru/ )

• Magnetospheric particles and radiation conditions | Университетский спутник
• Automatic gaze stabilization corrector | Университетский спутник "Ломоносов"
• Cosmic rays of extremely high energy | Университетский спутник "Ломоносов"

... about ERC . education . research . events . ... Being an effective way of acquiring knowledge, they also make a good addition to core lecture courses and involve students, postgraduates and scientists of other Russian higher education institutions and research centers in ERC activity in the initial stage. ... More information can be found at http://polly.phys.msu.ru/ru/unc/sconf.html . ... Conference on Development Prospects of Education and Research Centers in the Russian Federation . ...

Еще в разделе: (Показать все результаты (>12) - nano.msu.ru/ )

... News . ... Create new account (active tab) . ... Request new password . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 пЕпѕпґ) 219 (2016 пЕпѕпґ) 217 (2015 пЕпѕпґ) 215 (2015 пЕпѕпґ) 217 (2014 пЕпѕпґ) 215 (2014 пЕпѕпґ) 315 316 219 218 117 CAPTCHA . ...

Еще в разделе: (Показать все результаты (>196) - nanolab.phys.msu.ru/ )

• Contact khan | Laboratory of Nanophotonics & Metamaterials
• Contact khokhlova | Laboratory of Nanophotonics & Metamaterials
• Teaching | Laboratory of Nanophotonics & Metamaterials

... Nonlinear spectroscopy . Nonlinear fiber optics . Attosecond optics . ... qqqqqqqqqqqq Rapidly progressing fiber-optic technologies open new avenues in biophotonics, providing an advanced platform for the creation of novel fiber-based imaging systems optical endoscopes, biophotonics-oriented fiber laser sources and optical neural interfaces. ... Как правило более точные методы регистрации ионных токов (с помощью электродов) сильнее ограничены по числу одновременно регистрируемых нейронов. ...

Еще в разделе: (Показать все результаты (>5) - photonicslab.phys.msu.ru/ )

... MPI_Win_fenc win); A[rank] = 4; MPI_Win_fenc win); MPI_Put ( .. ... MPI-2 I/O: MPI - -, , - , MPI « » - , , . ... int MPI _File_close( MPI_File *fh) INOUT fh () , fh , fh, , MPI _FILE_CLOSE int MPI _File_set_view( MPI_File fh, MPI _ Offset disp, MPI_Datatype etype, MPI_Datatype filetype, char *datarep, MPI _Info info) I I I I I I N N N N N N OUT fh () disp () etype () filetype () datarep () info () int MPI _File_get_view( MPI_File fh, MPI _ Offset *disp, MPI_Datatype *etype, ...

Еще в разделе: (Показать все результаты (>4) - angel.cmc.msu.ru/ )

... Dear creators of the Bensons courses! First of all I would like to thank you for such a magnificent English course! ... Look, it's really much more interesting - to listen to a virtual book, to look through the pictures, let alone role-play! ... However, I'm very glad that I took up "Bensons" - the course has given me wonderful possibilities to learn more about English culture, to fill some gaps in my knowledge of English grammar and just to spend my time with great pleasure and benefit! ...

Еще в разделе: (Показать все результаты (>7) - anazarenko.ffl.msu.ru/ )

... История курсов . ... close this panel . ... Выпускной класс . Старшие классы . Младшие классы . ... Прием на курсы . ... График мероприятий . ... Телефоны, адреса . График работы . ... Приветствуем вас на сайте Общеуниверситетских подготовительных курсов.љ ... Обращаясь на курсы через форму "Задать вопрос", будьте внимательны при написании своего электронного адреса.љ . ... Сайт общеуниверситетских . подготовительных курсовљ . ...

Еще в разделе: (Показать все результаты (>4) - oupk.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

• ConClus

Neutron diffraction researches of nuclear and magnetic structure of new materials and its correlations with physical properties . Duration of training : 1 year . Supervisor of studies : A.M.Balagurov (professor, D.Sc., bala@nf.jinr.ru ) . ... In FLNP JINR there are unique opportunities for neutronography researches of nuclear and magnetic structure of crystals. ... Supervisor of studies: V.Yu.Pomjakushin (Ph. ... The near order and magnetic structure in amorphous magnetics. ...

Еще в разделе: (Показать все результаты (>30) - foroff.phys.msu.ru/ )

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>72) - fgp.msu.ru/ )

• http://fgp.msu.ru/wp-content/uploads/2013/12/Luce_Moscow_2013_small.pdf

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

114. Данные на картах в Интернет