... Master . ... Zel'dovich asteroid . ... August 29, 2013: Asteroid (11438) Zeldovich discovered 40 years ago . ... Asteroid (11438) has quite an elongated orbit with a period of 3.25 yr and eccentricity 0.19 (twice that of Mars). ... Asteroid will be located in Cancer constellation at the distance of 1.63 AU from Earth and 2.62 AU from the Sun (near the aphelion of its orbit), with the magnitude being 17.0m. Telescopes of MASTER network will definitely observe asteroid (11438) Zeldovich in early 2014....

Еще в разделе: (Показать все результаты (>10) - master.sai.msu.ru/ )

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>25) - nanofluidics.phys.msu.ru/ )

Preconcentration Laboratory . Laboratory of Chromatography . ... Laboratory of Kinetics Methods of Anaysis . ... Sorption-spectroscopy methods for determination of organic . ... Room-temperature ionic liquds, computational chemistry . ... New detection methods in ion and ion-pair chromatography . ... For that purpose, methods of selective preconcentration are developed along with the methods of determination of analytes directly in the sensing film or in the permeate after membrane diffusion. ...

Еще в разделе: (Показать все результаты (>13) - analyt.chem.msu.ru/ )

... IV, part 1 ACTA TRANSACTIONS Edited by N. N. Kazansky St. Petersburg Nauka 2008 RUSSIAN ACADEMY OF SCIENCES INSTITUTE FOR LINGUISTIC STUDIES CLASSICA ET INDOGERMANICA COLLOQUIA IV STUDIES IN CLASSICAL PHILOLOGY AND INDO-EUROPEAN LANGUAGES Edited by N. N. Kazansky Saint Petersburg Nauka 2008 Ilya Yakubovich HITTITE-LUVIAN BILINGUALISM AND THE DEVELOPMENT OF ANATOLIAN HIEROGLYPHS 1. ... The development of the Anatolian hieroglyphic script represented a long process. ... 18 Hittite-Luvian Bilingualism...

Еще в разделе: (Показать все результаты (>13) - imk.msu.ru/ )

• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/ENEMY.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/luwian.pdf
• http://www.imk.msu.ru/Structure/Linguistics/yakubovich/download/Armenian1.pdf

Journal of Cell Science 112, 2277-2289 (1999) Printed in Great Britain © The Company of Biologists Limited 1999 JCS0417 2277 Contribution of plus and minus end pathways to microtubule turnover I. A. Vorobjev1, V. I. Rodionov2, I. V. Maly1 and G. G. Borisy2,* 1Laborator 2Laborator y of Cell Motility, A. N. Belozersky Institute, Moscow State University, Moscow, Russia y of Molecular Biology, University of Wisconsin, 1525 ... Distal (plus) ends of MTs displayed dynamic instability. ...

Еще в разделе: (Показать все результаты (>27) - cellmotility.genebee.msu.ru/ )

• http://cellmotility.genebee.msu.ru/html/articles/komarova2002.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Vorobjev03.pdf
• http://cellmotility.genebee.msu.ru/html/articles/Grigoriev_2006a_CMC.pdf

CUDA Center of Excellence NVIDIA 22 « » ­ NVIDIA HPC Day. NVIDIA, , . Wen-mei W. Hwu (), , . 9:30 -- 10:00 10:00 -- 11:30 The Future of GPU computing Prof. Wen-mei W. Hwu 11:30 -- 12:00 Introducing Kepler: new generation GPU architecture Mark Ebersole , , 12:20 -- 13:20 , .. , .. , .. , .. 13:20 -- 15:00 GPU CUDA Prof. Wen-mei W. Hwu - « » : 2- , . 238 : http://ccoe.msu.ru

Еще в разделе: (Показать все результаты (>4) - ccoe.msu.ru/ )

• OpenACC: Вычисления на GPU с помощью простых директив | GPU Center of

Converters . A converter from ASCI GRD (Surfer, Golden Software Inc.) files into IPI data format. A converter from Res2dInv and IRIS SysCal files (Windows) . ... Runtime Error 200 - 'Divide by 0' on fast PCs. ... The cause of this error is a bug of Borland Pascal 7 . Now we found the way to solve this problem (on page "Fix for Borland Pascal" ). ... 119899, Russia, Moscow, Moscow State University, Geological Faculty, Department of Geophysics, Bobachev Alexei . ...

Еще в разделе: (Показать все результаты (>27) - geophys.geol.msu.ru/ )

... Mathematical models and methods in VLSI design . ... General models and statements about the complexity of combinatorial tasks, methods for development of fast algorithms (method of dynamic programming, ?divide and conquer?, ?method of model extension?) are considered. ... Mathematical models of contemporary electronic circuits are considered and basic approaches to solving task of logic synthesis, as well as tasks of VLSI modules placement and interconnection routing are described. ...

Еще в разделе: (Показать все результаты (>7) - hcs.cmc.msu.ru/ )

• Master program "Information Security and Cryptography" | Магистерское и
• Master programљ"Decision Engineering in Economics and Finance" | Магистерское и

... О проекте . ... A specialized source of quasi-?monochromatic X-?ray radiation for medical application is proposed. It includes two electron storage rings (E = 50 MeV) placed in the vertical plane and two laser resonators located in the horizontal and vertical planes. Hard X rays are generated in a process of back Compton scattering of laser photons ~1eV by electrons in the linear paths of storage rings. ...

Еще в разделе: (Показать все результаты (>7) - miles.sinp.msu.ru/ )

• Proposal of a Compact Repetitive Dichromatic X-ray Generator with Millisecond

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/megablast.out

The file a_news.php had been edited by : IP: 193.232.121.99 Time: 22.12.2008|12:28:34 This message had been generated by http://www.web2ftp.com On abuse issues, please contact abuse@web2ftp.com

112. Власова Татьяна Анатольевна

113. Anton O. Belyakov

114. Faculty's Tuition Structure

115. http://danp.sinp.msu.ru/Articles_GSIB/nimb206_902_Yamada_largeClasterIonCurrent.pdf

116. http://fgp.msu.ru/wp-content/uploads/2014/03/Information-Sheet.pdf

117. The 7th International Nanoscience Student Conference, London, 19?22 August 2013

118. http://beams.chem.msu.ru/doc/Dynamical_systems_Theory_and_applications.pdf

119. Botanical garden of Lomonosov Moscow State University

120. Redirect HTML