That is often an indication that Foswiki can't find the egrep and fgrep commands on your system. Check the {RCS}{EgrepCmd} and {RCS}{FgrepCmd} settings in configure . Back to: FrequentlyAskedQuestion . Related Topics: AdminDocumentationCategory . This topic: System > WebHome > UsersGuide > FrequentlyAskedQuestions > FAQSearchDoesNotWork . Topic revision: revision 1 . Copyright by the contributing authors. ... Ideas, requests, problems regarding Foswiki? ...

Еще в разделе: (Показать все результаты (>48933) - wiki.cmc.msu.ru/ )

• (backlinks in all Webs) HiddenAttachment < System < Foswiki
• (backlinks in System Web) HiddenAttachment < System < Foswiki
• (backlinks in System Web) FileAttribute < System < Foswiki

. Название публикации . Nuclear Magnetic Resonance Spectroscopy in Solving the Analytical Problems of Medicine: Analysis of Cerebrospinal Fluid . Авторы . T.N. Kolokolova, O.Yu. Savel'ev, N.M. Sergeev, O.A. Shpigun, K.V. Sokolov, V.I. Skvortsova . Дата . 31.12.2009 23:00:00 . Название журнала . Journal of Analytical Chemistry. Том . Vol.65 . Номер . 10. первая страница . 1073 . последняя страница . 1081. Купить нет на складе . 2009 ФФМ МГУ, 2009

Еще в разделе: (Показать все результаты (>9) - fbm.msu.ru/ )

Teaching Experience . Current lecture topics: Introduction in modern problems of Dynamical Systems Theory . ... Methods of Mathematical Physics (2003-2009) . Introduction in Theoretical Physics (topics in Statistical Physics of Networks) (2006-2009) . ... Theoretical Physics (Classical Mechanics, Quantum Mechanics, Statistical Mechanics, Electrodynamics) (2000-2005) . Experience as a supervisor of PhD studies: 2 PhD are defended under my surevision; 2 PhD students recently. ...

Еще в разделе: (Показать все результаты (>71) - chaos.phys.msu.ru/ )

• Science
• Activities
• Staff

. Backlinks to FileAttribute in System Web ( Search all webs ) . UserDocumentationCategory . A List of User Documentation $ AccessKeys : Access keys are keyboard shortcuts which allow the user to navigate around a website or a piece of computer software ... NEW - 02 Sep 2010 - 17:49 by ProjectContributor . Number of topics: 1 . Copyright by the contributing authors. All material on this site is the property of the contributing authors. Ideas, requests, problems regarding Foswiki? Send feedback

Еще в разделе: (Показать все результаты (>23262) - wiki.cs.msu.ru/ )

• (backlinks in all Webs) HiddenAttachment < System < Foswiki
• (backlinks in System Web) HiddenAttachment < System < Foswiki
• (backlinks in System Web) FAQSimultaneousEdits < System < Foswiki

... Terrestrial ecosystems . Research . ... Environmental pollution and protection in the Norwegian-Russian border area are the main themes of research cooperation between the Soil Science Faculty of Moscow State University (MSU) and the Norwegian Forest Research Institute (NISK). ... The bilateral scientific cooperation between Norway and Russia was established in 1988, based on joint governmental agreement on environmental problems. ... Norwegian Forest Research Institute, Norway . ...

Еще в разделе: (Показать все результаты (>22) - eco.soil.msu.ru/ )

• Koptsik G.N., et al. Soils of the National Park "Russian North".
• CLEANSOIL, An innovate method for the on-site remediation of polluted soil
• ASSESSMENT OF SOIL SUSTAINABILITY TO ACID DEPOSITION

Information letter Dear colleagues! Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science would like to invite you to participate in the work of the VII Russian National School with International Participation on Muscle and Exercise Physiology «New approaches to studying of classical problems». ... Abstracts of reports will be published. ... The receipt of your abstract will be confirmed by e-mail. ...

Еще в разделе: (Показать все результаты (>5) - www.fbm.msu.ru/ )

... It is shown that their chemical activity , crystal structure and other properties dramatically depend on fluorine atomic structure and on characteristics of chemical bonds in fluorides. ... 1886 F2 CaF2 ( ) . ... F (NaHF2 , KHF2 , NH4HF2 ­ ), (, HF H2O - 36° ), ( HF), : - HF + aq H+·aq + F -·aq + HF2 ·aq (HF)nF -·aq, n = 2­4 , - KF + HF K+ + HF2 , - SbF5 + HF H2F+ + SbF6 , 3HF - HF2 + H2F+ ( ) .. ... CaF2 . ... 1986. ... BeF2 (), Al2O3 + Na3AlF6 (), () ZrF4 (HfF4) () K2ZrF6 (K2HfF6) (), K2TaF4 (). ...

Еще в разделе: (Показать все результаты (>19) - www.inorg.chem.msu.ru/ )

• http://www.inorg.chem.msu.ru/matsci/hydrothermal/pdf/balakhonov_cv.pdf

Вы посетили: conf_engl.html . ... International Algebraic Conference dedicated to 70th birthday of professor A.V. Mikhalev, Russia, Moscow, November 2010 . ... International Algebraic Conference dedicated to the 100-year anniversary of professor A.G. Kurosh, Russia, Moscow, May 2008 . ... 2nd International Conferences on Matrix Methods and Operator Equations, Russia, Moscow, July 2007 . ... staff/guterman/conf_engl.html.txt Последние изменения: 13.02.2013 11:26 (внешнее изменение) | ...

Еще в разделе: (Показать все результаты (>15) - halgebra.math.msu.su/ )

• staff:guterman:conf_rus.html | Кафедра высшей алгебры
• Нерешенные задачи теории групп

... Seminar archive . ... Seminar archive 2012 22 June . ... Гнедин О. Ю. Numerical simulations of galaxy formation, based on the cold dark matter model, explain the observed large-scale structure and abundance of massive galaxies. ... Many more dwarf galaxies around large galaxies are predicted than observed, leading to the "missing satellites problem". Much more cosmic gas inside galaxy halos is predicted than observed, leading to the "missing baryons problem". ... All seminars: . ...

Еще в разделе: (Показать все результаты (>22) - master.sai.msu.ru/ )

• Master net
• YaB-100 - Participants

... Two-dimension linear regression model. ... The econometric modeling of time series . ... The course aims to provide students with basic models and methods of econometric modeling of financial time series. ... The course considers in detail the major methods of econometric modeling of time series, in particular modeling by stochastic processes, modeling of stationary and non-stationary time series, the spectrum analysis of time series. ... The problem of tax optimization under a given state budget. ...

Еще в разделе: (Показать все результаты (>22) - io.cmc.msu.ru/ )

Transhumus : Integrated software solution for interpretation of FT-ICR mass spectra of natural organic matter Anton Grigoryev1, 2, Alexey Kononikhin 1 2 2, 3 , Irina Perminova4, Eugene Nikolaev2, 3 ansgri@gmail.com Institute for Energy Problems of Chemical Physics, Moscow , Russia 3 Institute of Biochemical Physics, Moscow , Russia 4 Lomonosov Moscow State University, Moscow , Russia Natural organic matter ( ... However, there still are problems with interpretation of mass spectra of NOM. ...

Еще в разделе: (Показать все результаты (>129) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-vladimirov-combination.pdf
• http://www.mgumus.chem.msu.ru/publication/2008/2008-kulikova-uptake.pdf
• http://www.mgumus.chem.msu.ru/publication/2013/2013-Kostyukevich-etal.pdf

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>3) - mouse.genebee.msu.ru/ )

Prague, August 16, 2006 . Another problem that was making it difficult to automatically merge GCVS and survey catalogs has been recently solved: 'old' variable stars also had only very rough coordinates. The GCVS has been identified, on a star-by-star basis, with positional catalogs. ... The total number of stars we were unable to identify, at least tentatively, is only 200, most of them from two or three sources of especially unreliable positional information. ...

Еще в разделе: (Показать все результаты (>103) - sai.msu.ru/ )

• Future Prospects of Variable-Star Catalogues
• European Astronomical Society(EAS): NEWS

Studying of Influence UVB Radiation on Plants by Methods of EPR-Radiospectroscopy and Mathematical Model Khalilov R.I.,1Nsibova .N. Baku State University, Azerbaijan. ... Influence UV irradiation on kinetic of photoinduced of electronic transport and paramagnetic properties isolated chloroplasts and leaves of higher plants is investigated. ... UV irradiation thylakoid membranes chloroplast is accompanied by increase in sixcomponential signal Mn2+ and increase of an egress of hydrogen peroxide. ...

Еще в разделе: (Показать все результаты (>64) - www.msm.biophys.msu.ru/ )

• MSM 2007

... An approach to the hybrid quantum mechanical and molecular mechanical (QM/MM) theory based on the effective fragment potential (EFP) technique (M. Gordon and co-authors) for modeling properties and reactivity of large molecular systems of biochemical significance is being developed. Currently we are preparing a novel version of the computer program based on the most recent variant of the PC GAMESS quantum chemistry package (A. A. Granovsky) and the TINKER molecular modeling package (J. Ponder). ...

Еще в разделе: (Показать все результаты (>20) - lcc.chem.msu.ru/ )

• Laboratory of Chemical Cybernetics

Alexander S. Antonov . ... M.V.Lomonossov Moscow State University . ... June 4, 1999, Moscow State University . ... 1994-2000: programmer, Laboratory of Parallel Information Technologies, Research Computer Center, Moscow State University . ... A.S. Antonov, A.M. Teplov. ... Antonov A.S., Voevodin Vl.V., Sobolev S.I., Filamophitskiy M.P. Internet-Auditorium of Lomonosov Moscow State University // Abstracts of the All-Russian scientific conference "Scientific Services Internet" (Novorossiysk, 2000). ...

Еще в разделе: (Показать все результаты (>8) - asa.guru.ru/ )

. 21.04.2014-23.04.2014 . Вход . Enter .

118. Large-Scale Load Stabilization

119. Кафедра математических и компьютерных методов анализа

120. FBB