Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>3) - genseq.fbb.msu.ru/ )

Cell Biology International 27 (2003) 293ґ294 Cell Biology International www.elsevier.com/locate/jnlabr/ycbir Short communication Microtubule dynamics in living cells : direct analysis in the internal cytoplasm Ivan A. Vorobjev a a,* , Irina B. Alieva a, Ilya S. Grigoriev b, Gary G. Borisy c Laboratory of Cell Motility, A.N. Belozersky Institute, Moscow State University, Moscow, Russia b Department of ... These data demonstrate that MT growth is impeded at the cell margin. ...

Еще в разделе: (Показать все результаты (>27) - cellmotility.genebee.msu.ru/ )

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

Synthesis and Use of Humic Derivatives Covalently Bound to Silica Gel for Np(V) Sequestration I.V. Perminova , L.A. Karpiouk, N.S. Shcherbina*, S.A. Ponomarenkoї, St.N. Kalmykov, and K. Hatfield Department of Chemistry, Lomonosov Moscow State University, Moscow 119992, Russia Vernadsky Institute of Geochemistry and Analytical Chemistry, Russian Academy of Sciences, Moscow 119991, Russia ї Institute of Synthetic Polymer ... I.V. Perminova, et al. ...

Еще в разделе: (Показать все результаты (>95) - mgumus.chem.msu.ru/ )

• http://www.mgumus.chem.msu.ru/publication/2010/2010-kazachkov-optimization.pdf
• http://www.mgumus.chem.msu.ru/publication/2007/perminova-preparation-2007.pdf
• MGUMUS -- Researches

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

... Abstract A Uniform Resource Identifier (URI) is a compact string of characters for identifying an abstract or physical resource. ... This document defines a grammar that is a superset of all valid URI, such that an implementation can parse the common components of a URI reference without knowing the scheme-specific requirements of every possible identifier type. ... URI-reference = [ absoluteURI | ... Otherwise, the reference URI's scheme is inherited from the base URI's scheme component. ...

Еще в разделе: (Показать все результаты (>4) - hea-www.harvard.edu/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1945.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc1808.txt

... The surface mixed layer of the ocean is often characterized by density compensation between the horizontal temperature and salinity gradients. ... The coupling arises through a nonlinear diffusion operator proportional to the buoyancy gradient, which parameterizes the combined effect of slumping and mixing of small-scale horizontal buoyancy gradients. ... Mesoscale stirring will create small-scale temperature and salinity gradients by stretching and folding the large scale thermohaline patterns. ...

Еще в разделе: (Показать все результаты (>12) - ocean.phys.msu.ru/ )

• http://ocean.phys.msu.ru/courses/geo/lectures-addons/15/2001%20Demorest%2C%20Dynamo%20theory%20and%20Earth's%20magnetic%20field%20.pdf

... Ядро МАТЛАБ содержит более тысячи функций. ... Кадр из анимационной сцены [pic] Исходный код S- функции , написанной на языке C++ с использованием библиотеки OpenGL для отображения анимационной картинки перемещения маятника на движущейся ... _GENERATE_TLC 1 #define SOURCEFILES #define PANELINDEX 6 #define SFUNWIZ_REVISION 2.0 #include simstruc.h static double x1 = 0, x2 = 0, x1_ = 0, x2_ = 0, X = 0; static double l1,l2; static int glInited = 0; static HWND hGlWindow = NULL ; static ...

Еще в разделе: (Показать все результаты (>2) - ndsipu.cmc.msu.ru/ )

... Scaliger sometimes forgot as anyone will when doing chronological computations whether he sought a current or a completed year, and therefore gave Julian dates that did not actually match the cyclical dates his computations had determined (e.g. eras 37,42, and 49). ... This table lists all the eras explicitly given as such by Scaliger, with their positions in the Julian Period and their dates in years BC or AD. ... To find a year in this era, subtract 296 from the date in the era of the Hegira. ...

Еще в разделе: (Показать все результаты (>95) - hbar.phys.msu.ru/ )

• newtrev2.htm

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>30) - nanofluidics.phys.msu.ru/ )

• Teaching

Apache2 Ubuntu Default Page . It works! This is the default welcome page used to test the correct operation of the Apache2 server after installation on Ubuntu systems. ... Ubuntu's Apache2 default configuration is different from the upstream default configuration, and split into several files optimized for interaction with Ubuntu tools. ... The configuration layout for an Apache2 web server installation on Ubuntu systems is as follows: /etc/apache2/ |-- apache2.conf | ... Document Roots . ...

117. Факультет иностранных языков МГУ. Центр Дистанционного обучения.

118. A. Kh. Pergament - Computational Mechanics Department

119. Department of General Physics and magneto-ordered matter. Physics Department of

120. http://hit-conf.imec.msu.ru/2012/abstracts/AbstractKonyukhovLikhachev.doc