... WN_LIST=/ opt / glite / yaim /etc/wn-list.conf USERS_CONF=/ opt / glite / yaim /etc/users.conf GROUPS_CONF=/ opt / glite / yaim /etc/groups.conf FUNCTIONS_DIR=/ opt / glite / yaim /functions OUTPUT_STORAGE=/tmp/jobOutput # Set this to your prefered and firewall allowed port range GLOBUS_TCP_PORT_RANGE= 20000,25000 PX_HOST=lcg14.sinp.msu.ru BDII_HOST=lcg-bdii. cern .ch MON_HOST=my-mon. cern .ch REG_HOST=my-reg ...

Еще в разделе: (Показать все результаты (>12) - lhe.sinp.msu.ru/ )

• MSU.ru Atlas computing

... The students of the Faculty of Geography study territorial distribution and spatial development patterns of various natural phenomena as well as social and economic objects. ... The academic program includes courses with lectures, seminars, laboratory and field training in natural sciences and humanities which form 4 blocks: . ... In addition to the field stations of the Faculty, the students have an opportunity to have their field training in scientific institutions and different companies. ...

Еще в разделе: (Показать все результаты (>38) - eng.geogr.msu.ru/ )

• Department of Cartography and Geoinformatics

... CELL BIOPHYSICS Application of a Photosystem II Model for Analysis of Fluorescence Induction Curves in the 100 ns to 10 s Time Domain after Excitation with a Saturating Light Pulse N. E. Belyaevaa, V. Z. Pashchenkoa, G. Rengerb, G. Yu. ... In the case of weak measuring light, the steady-state level of fluorescence induction curve (Fig. ... The model of PSII predicted that, upon long (10 s) exposure to weak measuring light, the states with open RCs are being populated (Fig. 4, curves 3, 5 QA). ......

Еще в разделе: (Показать все результаты (>37) - library.biophys.msu.ru/ )

• http://library.biophys.msu.ru/PDF/3347.pdf
• http://library.biophys.msu.ru/PDF/3343.pdf

. Lab . Main page News People . ASA . Master . Master net Homepage . Login . SAI MSU 20-21 March 2014 . English Русский . Homepage . Programme and presentations . Participants . Biography . Zel'dovich asteroid . Photoarchive . Contacts . YaB-100 conferences . online . ASA . Wikipedia . Yakov Borisovich Zel'dovich (memoirs, letters, documents) / Edited by S.S. Gershteyn and R.A. Sunyaev. Zel'dovich planet

Еще в разделе: (Показать все результаты (>11) - master.sai.msu.ru/ )

• International Workshop ?Robotic observatories?

... Moscow State University Belozersky Institute of Physico-Chemical Biology . The Department of Electron Microscopy offers positions in the area of molecular biology of the cell for excellent and highly motivated biologists at under-graduate or post-graduate level. Students : We are constantly offering diploma thesis and PhD thesis projects for students in cell biology and biophysics. The applicant is expected to have a strong interest in either experimental activity or computer modeling. ...

Еще в разделе: (Показать все результаты (>2) - cellbiol.genebee.msu.ru/ )

... Electronic journal Issue 4. 10 september 2004 Paliulis N., Chlivickas E. E-government as a Challenge of Public Management Development Introduction. ... This also includes the transfer of various data from hardcopies (documents) to digital media (databases), provision of information and services to citizens and businesses via electronic means (websites, e-mails, etc.) ... The main obstacle for the development of electronic public services is the small number of Internet users in Lithuania. ...

Еще в разделе: (Показать все результаты (>8) - e-journal.spa.msu.ru/ )

... Garbe, Dietmar Journal fЭr die reine und angewandte Mathematik Volume 237 / 1969 / Article Nutzungsbedingungen DigiZeitschriften e.V. gewДhrt ein nicht exklusives, nicht Эbertragbares, persЖnliches und beschrДnktes Recht auf Nutzung dieses Dokuments. ... Das Copyright bleibt bei den Herausgebern oder sonstigen Rechteinhabern. ... Terms of use DigiZeitschriften e.V. grants the non-exclusive, non-transferable, personal and restricted right of using this document. ...

Еще в разделе: (Показать все результаты (>40) - dfgm.math.msu.su/ )

• Носовский Г.В. / Кафедра Дифференциальной геометрии и приложений /

Les Иtudiants Иtrangers Ю la facultИ de la Politique Internationale. La facultИ de la Politique Internationale offre aux Иtudiants Иtrangers (du proche Иtranger et de l'Иtranger lointain) la formation dans le domaine des relations internationales - 41.03.05 - « Les Relations Internationales». ... En dehors des cours magistraux ils apprennents la langue russe et ils font leur connaissance de la culture et de l'histoire de la Russie. ... L'original de l'annexe du document sur la formation 4. ...

Еще в разделе: (Показать все результаты (>2) - fmp.msu.ru/ )

• Admissions

Electron and proton impact ionization of atoms and molecules . Theory of few-body Coulomb scattering This is one of the major topics in the research activity of our laboratory. ... Electron momentum spectroscopy (EMS) EMS is the (e,2e) method involving high incident energy and large momentum transfer. ... We develop a theory of the single- and double-ionization EMS processes in atomic and molecular systems. ... c) Laboratory of mathematical models of quantum scattering processes, 2012 . ...

Еще в разделе: (Показать все результаты (>5) - lmmqsp.sinp.msu.ru/ )

... IPI-1D is a set of programs for processing and interpretation of VES data within the framework of horizontally layered models . ... Except programs already listed above, our specialists developed some programs for modeling, studying, visualization and interpretation of resistivity data in anisotropic media (anisotropic halfspace, horizontally layered media with anisotropic basement and vertical contact of two anisotropic media). ...

Еще в разделе: (Показать все результаты (>52) - geophys.geol.msu.ru/ )

• x2ipi
• Software for resistivity and induced polarization
• Near-surface electrical prospecting laboratory at Moscow University

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>17) - mph.cmc.msu.ru/ )

• http://mph.cs.msu.ru/mph/pap/txt/fedotov.doc

... The main interest of researchers was focused on TiO2:Co and TiO2:V thin films, that reveal an essential difference in their behavior: TiO2:Co films demonstrate either strong magnetization, MO response or AHE independently on presence or absence of magnetic Co clusters inside the films. ... It has been found that: thin films TiO2:Co(0.5%, 1.3% and 5%) have either magnetization or MO signal of Transversal Kerr effect with the absence of magnetic clusters. ...

Еще в разделе: (Показать все результаты (>11) - magn.phys.msu.ru/ )

... The Symposium's three breakout sessions focused on risks from different perspectives: enterprise use, resource constrained environments, and combating malicious use. ... Specifically, a DNS collaborative response, awareness, technical training, and future DNS security, stability, and resiliency collaboration should take precedence within the issues selected for further study and implementation. ... Breakout Session Overview.. ... 30 Appendix F: Combating Malicious Use Breakout Session Guide Book .. ...

Еще в разделе: (Показать все результаты (>14) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/nostr/d_3-3.doc
• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/crain_pres.pdf

... Submit your article . ... Public Administration publishes scholarly articles on theory, methodology and practice of management, results of applied research projects in administration, studies of Russian and foreign administration experience, bibliographical reviews and information on conferences, round tables and workshops. ... The journal accepts polemic articles. ... All articles submitted for publication are first reviewed for compliance with the guidelines for article formatting and content. ...

Еще в разделе: (Показать все результаты (>96) - ee-journal.spa.msu.ru/ )

системы автоматизации, автоматизированные системы , информационные системы , мобильные и встраиваемые системы , программное обеспечение, вычислительные системы , средства связи,базы данных, информационные технологии,технологии программирования, обработка изображения, параллельные вычисления, информационное моделирование,математическое моделирование, вычислительный эксперимент, информатика,методы вычислений, численный анализ, numerical ...

Еще в разделе: (Показать все результаты (>15) - adept.srcc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

... Предыдущее сообщение: PARALLEL.RU - Новости, специальный выпуск [09/12/2011] . ... НОВОСТИ МИРА ВЫСОКОПРОИЗВОДИТЕЛЬНЫХ ВЫЧИСЛЕНИЙ http :// parallel.ru /news/ + В Noblis Center for Applied High Performance Computing установлен суперкомпьютер Cray XMT. http ://www.noblis.org/NewsPublications/News/NewsReleases/Documents/PRSupercomputerArrival.pdf + В University of Western Australia будет установлен суперкомпьютер SGI Rackable на базе процессоров Intel Xeon X5650 и ГПУ Nvidia C2075 ...

Еще в разделе: (Показать все результаты (>112) - mail.parallel.ru/ )

• PARALLEL.RU - Новости, выпуск #268 [07/07/2009]
• PARALLEL.RU - Новости, выпуск #311 [08/07/2011]
• PARALLEL.RU - Новости, выпуск #282 [02/03/2010]

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.ru Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.ru/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

. Name . Last modified . Size . Description . Parent Directory . - . 2014 2015/ . 18-Dec-2014 09:26 . - . 2015 2016/ . 09-Feb-2016 14:24 . - . About Lab/ . 20-Apr-2011 14:58 . - . Anketa/ . 14-Apr-2015 09:59 . - . Apache/2.2.3 (CentOS) Server at jaffar.cs.msu.su Port 80

Еще в разделе: (Показать все результаты (>12) - jaffar.cs.msu.su/ )

• Index of /mash/os/2014 2015
• Index of /mash/os/2015 2016
• Index of /mash/os/About Lab

... Department of Computational mathematics and cybernetics , Lomonosov Moscow State University . ... Thesis title "Machine learning approach for automatic performance tuning of parallel program", supervisor Dr. Nina N. Popova. ... High-performance computing, automatic performance tuning, machine learning algorithms, evolutionary and bio-inspired programming, parallel algorithms in VLSI design . ... Algorithms and framework for automatic selection and tuning parameters of parallel sparse linear solvers....

Еще в разделе: (Показать все результаты (>6) - angel.cmc.msu.ru/ )

• Index of /~basrav/supercomp2010