... 2 · ­ , , · ­ · ­ , 03.12.2015 . ... 14 03.12.2015 · · · 03.12.2015 . ... Verifier Uni ve rsi ty of Te x as 2013 Anteater Uni ve rsi ty of Il l i noi s 2011 FlowChecker Uni ve rsi ty of North Carol i na 2010 VERMONT Network disjoint Port #02 Port #03 h2 h3 s1 Port #01 h1 Port #04 h4 main: disjoint() := Forall[x, out_x, y, out_y: !R(x, out_x) or !R(y, out_y) or x[p] == out_y[p] and out_x[p] == y[p] or x VERMONT proxy CLI Packets are delivered through the control plane We can block them! ...

Еще в разделе: (Показать все результаты (>6) - lvk.cs.msu.su/ )

• http://lvk.cs.msu.su/~bahmurov/course_advanced_networks/ITU_OTN_Tutorial.pdf

... Electronic journal Issue 4. 10 september 2004 Leigh E. Making Learning a Game Introduction. As a university lecturer I enjoy playing games with learning goals in mind. My students are all adults who work in many different roles. ... Their needs include learning how to design activities that will support acquisition of practical skills, extend personal understanding of emotional factors, and improve awareness of factors ­ such as economic, ecological and political aspects of society. ... Play. ...

Еще в разделе: (Показать все результаты (>7) - e-journal.spa.msu.ru/ )

• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./vorontchuk.pdf
• http://e-journal.spa.msu.ru/uploads/vestnik/2004/vipusk_4._sentjabr_2004_g./bonham_surin.pdf

... General astronomy . ... PHYSICAL CONSTANTS.. ... Nobel Laureates in Physics 1901-2002 . ... Lectures Astronomy-161 "Solar System" (Also it contains info about History of Astronomy) . ... The History of Science . ... College-Level Astronomy Courses - at American, Australian Universities and Colleges . ... Messier: . ... Science . ... Scientific American . ... JOURNAL OF COMPUTATIONAL PHYSICS . ... Scientific Journals . ... American Physical Society Journals: Physical Review, Review of Modern Physics ...

Еще в разделе: (Показать все результаты (>11) - astrometric.sai.msu.ru/ )

... Conformational Analysis of Boron-Containing Compounds Using Gillespie-Kepert Version of Molecular Mechanics . ... Abstract - Molecular mechanics force field for boron-containing compounds based on CHARMM parameters and Gillespie-Kepert (GK) model is developed. ... The force field provides an accurate description of experimental X-ray stereochemistries in a wide range of organoboranes, organoborate complexes with polyhydroxy compounds, mixed oligomers of boric acid and borates. ...

Еще в разделе: (Показать все результаты (>27) - analyt.chem.msu.ru/ )

• Study of amino- and pyridyl-containing zinc(II) and cadmium(II) complexes by

Научно-образовательный центр Геномного секвенирования МГУ . ... Sep 11, 2014, 9:17 AM . Yegor Bazykin attached NGS_supported_list.pdf to Результаты конкурса NGS-проектов . ... Yegor Bazykin deleted attachment NGS_supported_list.pdf from Результаты конкурса NGS-проектов . ... Yegor Bazykin edited Конкурс NGS-проектов . ... Yegor Bazykin created Результаты конкурса NGS-проектов . Jul 5, 2014, 2:53 AM . Yegor Bazykin updated polozhenie.pdf . ... Recent Site Activity | ...

Еще в разделе: (Показать все результаты (>2) - genseq.fbb.msu.ru/ )

... ICONO Invited Speakers . ... Gennadiy Kulipanov, Budker Inst. of Nuclear Physics, Russia . ... Marlan Scully, Texas A&M Univ., ... Andrey Goncharov, Inst. of Laser Physics, Russia . ... Vladimir Trunov, Inst. of Laser Physics, Russia . ... Since 1987, he has worked at the National Research Council of Canada (Ottawa) in the field of laser physics and trapped ion optical frequency standards. ... Alexey Taichenachev , Inst. of Laser Physics, Russia . ... S. Vatnik, Inst. of Laser Physics, Russia . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

• Symposia
• Excursions

О НЕУСТОЙЧИВОСТИ СХОДЯЩИХСЯ УДАРНЫХ ВОЛН ПОЛИГОНАЛЬНОЙ ФОРМЫ А.В. Конюхов, А.П. Лихачев Объединенный институт высоких температур РАН, Москва Как известно [1], сходящиеся цилиндрические (сферические) ударные волны неустойчивы по отношению к потере пространственной симметрии с тенденцией к возникновению полигональной (полиэдральной) формы. ... Whitham, G. B., 1974 Linear and Non-linear Waves. ... Schwendeman, D. W., Whitham, G. B. On converging shock waves // Proc. R. Soc. ...

Еще в разделе: (Показать все результаты (>11) - hit-conf.imec.msu.ru/ )

... Book 1 Containing the years from the beginning of the World, or from the year of the Juliam Period 730 unto the third of Solomon, which is the 3702 year of the same Period . ... Book 5 Containing years from the first of CHRIST to the Thirty fourth . Book 6 Wherein are contained the years from the 304 of CHRIST unto 491 . Book 7 Wherein are contained the years from the 491 of CHRIST unto 641 . Book 8 Wherein are contained the years from the 641 of CHRIST unto 1100 . ...

Еще в разделе: (Показать все результаты (>87) - hbar.phys.msu.ru/ )

• Appendix: Scaliger's List of Eras

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>7) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Biological membranes. Structure, properties, functions Abstract Biological membranes, together with cytoskeleton, form the structure of living cell. ... Each membrane type contains a specific set of proteins - receptors and enzymes but the base of every membrane is a bimolecular layer of lipids (lipid bilayer) that performs in each membrane two principal functions: (1) a barrier for ions and molecules, and (2) structural base (matrix) for functioning of receptors and enzymes. ... Fig.2. ...

Еще в разделе: (Показать все результаты (>16) - foroff.phys.msu.ru/ )

• http://foroff.phys.msu.ru/phys/med/engl_ver/evc_06ep.pdf
• Postdoctoral training (Neutronography)

... Scientific educational events were organized at the Chair and the Faculty in the framework of the All-Russian School RESEARCH AND EDUCATIONAL PROJECTS on Global Social and Natural Processes in Interdisciplinary AND ACTIVITIES Studies as a joint action with the MSU Youth Council on Federal Task Program aimed at the inclusion of young Scientific research studies done by students of people in the scientific educational innovation processes the Chair and the Faculty were praised at the in Russia. ...

Еще в разделе: (Показать все результаты (>16) - fgp.msu.ru/ )

• http://www.msu.ru/en/admissions/general-programs/docs/FACULTY%20OF%20GLOBAL%20STUDIES.pdf
• Search Results п¤п“пџ пњп“пе пёпј. пњ.п’. п›пѕпјпѕпЅпѕяЃпѕпІп°

... Measurement of the MASS detectors parameters with mass program January 24, 2015 [112707] . MASS/DIMM electronics. ... Turbina-core(D): Dimm User Guide. ... N.Shatsky, V.Kornilov, The revision of the MASS/DIMM star catalogue. ... О.Возякова, В.Корнилов, Н.Шатский, Новое программное обеспечение прибора MASS/DIMM. ... V.Kornilov, N.Shatsky, S.Potanin, O.Voziakova, B.Safonov Preliminary results of astroclimate parameters measurements at the Sternberg 2.5m telescope installation site. ...

Еще в разделе: (Показать все результаты (>20) - curl.sai.msu.ru/ )

. Name . Last modified . Size . Description . about_center/ . 14-Sep-2013 14:31 . - . sections/ . 31-Oct-2007 14:46 . - . Apache/2.2.16 (Debian) Server at educenter.sinp.msu.ru Port 80

Еще в разделе: (Показать все результаты (>9) - educenter.sinp.msu.ru/ )

• Index of /about_center/workplaces

... hall in front of room 01, MSU, Main Building . ... room 01, MSU, Main Building . ... Silvia Chelala (Empire State College, State University of New York, Old Westbury, New York, USA) Designing and Teaching Introductory Spanish as a Foreign Language at a Distance . ... FFL, recreation hall, 3rd floor . ... FFL, room 519 . ... FFL, room 501 . ... FFL, . room 107-108 . ... Internet-Supported Teaching . ... FFL, room 106 . ... FFL, room 416 . ... FFL, room 420 . ... FFL, room 210 . ...

Еще в разделе: (Показать все результаты (>5) - anazarenko.ffl.msu.ru/ )

• Факультет иностранных языков МГУ им.М.В.Ломоносова

Head of sector, acting head of the Computational Geophysics Division of the M.V. Keldysh Institute for Applied Mathematics, RAS. ... Finished the Electrodynamics and Quantum Theory Department of Faculty of Physics, MSU in 1962. ... Ill-posed problems, stochastic processes, theory of approximation. Mechanics and physics of multi-phase media, phenomena in porous media, difference schemes for some classes of mathematical physics problems (filtration, elasticity theory). ...

Еще в разделе: (Показать все результаты (>4) - compmech.math.msu.su/ )

... General Information . ... For physics faculty . ... Until 1939 in Moscow State University there was one undivided General Physics Chair. ... He was a leading scientist in the field of magnetic phenomena, and during 14 years the experimental and theoretical research of condensed matter magnetization, magnetic hysteresis and ferromagnetic resonance have been conducted under his leadership. ... In 2003 the Chair was renamed to Chair of General Physics and Magneto-Ordered Matter. ...

Еще в разделе: (Показать все результаты (>5) - ferro.phys.msu.ru/ )

Международный учебно-научный лазерный центр МГУ им. М.В. Ломоносова . ... О МЛЦ МГУ . ... Абстракт: The current status of studies in the physics of entangled states of atomic systems Р an interdisciplinary field involving quantum optics, quantum information, and the foundations of quantum mechanicsРis reviewed. ... In the second part, experiments on the creation and detection of entangled states in atomic systems are discussed along with associated experimental proposals for their refinement. ...

Еще в разделе: (Показать все результаты (>40) - ilc.phys.msu.ru/ )

• Conference

... The linguistic aspects of the model and the properties of the semantic dictionary ensuring the content analysis with compression of the text structure are considered. Our dictionary resources serve an instru- ment for building a multilevel textual semantic structure. ... Reason (A,B), where SemF(A) = SIT or a whole semantic formula; the same for SemF(B). ... Sem(SIT)R . ... Semantic Resources for Textual Content Compression // Fourth International Conference on Meaning-Text Theory (MTT'09). ...

Еще в разделе: (Показать все результаты (>5) - leontyeva.srcc.msu.ru/ )

• Lexical Resources for Personal Data Recognition in Texts

... WRF (Weather Research and Forecasting Model) [9]. ... NOAH LSM (National Centers for Environmental Prediction, Oregon State University, Air Force, Hydrology Lab-NWS Land Surface Model) [3]. ... WRF ­ (Urban Canopy Model, UCM) [6] (Building Environment Parameterization, BEP) [8]. ... C ­ ( HA = r · HR + rw·Ha ). , r ­ ( UCM NOAH LSM « » , , , (, .) H = A H ­ , LSM +A HA , (, H ­ ; A , , ); A ­ , (, , ); HLSM ­ , NOAH LSM; HA ­ , UCM. ... 48 1 29 2007 00 . ... WRF) : - NOAH; UCM - ; BEP - . ...

Еще в разделе: (Показать все результаты (>5) - atm563.phys.msu.ru/ )

Laboratory of Microfluidics and Nanofluidics . Laboratory of Physical Chemistry of Modified Surfaces . ... Research . ... Laboratory of Micro- and Nanofluidics . ... Professor B.V.Derjaguin moved to the Laboratory with his research group as an Emeritus Professor. ... In 1993 Professor Olga I. Vinogradova took over the leadership of the Laboratory. In 2009 the Laboratory of Micro- and Nanofluidics was organized by Professor Olga I. Vinogradova at the Physics Department of the M.V.Lomonosov MSU. ...

Еще в разделе: (Показать все результаты (>33) - nanofluidics.phys.msu.ru/ )

• Teaching