... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/nhunt-2.out

Next] [Previous] [Top] [Contents] [Index] [netCDF Home Page] [Unidata Home Page] . ... The Unidata Program Center has developed a units library to convert between formatted and binary forms of units specifications and perform unit algebra on the binary form. Though the units library is self-contained and there is no dependency between it and the netCDF library, it is nevertheless useful in writing generic netCDF programs and we suggest you obtain it. ... Celsius . ... nit (unit of photometry) . ...

Еще в разделе: (Показать все результаты (>17) - angel.cs.msu.su/ )

• : Class StringCharAdapter

... Alternative core new atoms (%) . ... An alignment of a set of structures is a set of positions , to each position some atoms from different structures correspond. ... Geometrical core of a set of structures is a subset of alignment positions those atoms are disposed similarly in all structures. ... For any two positions included into geometrical core, the distances between CA atoms of those positions in all structures may differ not more than the value of the parameter "Distance spreading". ...

Еще в разделе: (Показать все результаты (>4) - mouse.belozersky.msu.ru/ )

• NPG-explorer

This page is in KOI-8 encoding . 2D inversion results for the VES field data obtained near Sevastoplol (the Ukraine) with the . ... The objective of the survey was to study the lambstone massif (the right-hand part of the cross-section) embedded in the litified clays (the central and the left-hand part of the cross-section). ... According to the geological data, it is likely that the lambstone block forms the landslide body slipping over the water-saturated litified clays. ...

Еще в разделе: (Показать все результаты (>37) - geophys.geol.msu.ru/ )

... Assume that gas is a thermodynamic system in the state of local equilibrium, that is, it is satisfied the relation [2] [pic] (1) There [pic],[pic] and [pic] are the temperature, the pressure and the gas volume, [pic], [pic] are entropy and internal energy per unit volume. ... Let us consider the first-degree form [pic]. ... Since the evolutionary relation is not identical, from this relation one cannot get the state differential [pic] that may point to the equilibrium state of the material system. ...

Еще в разделе: (Показать все результаты (>18) - hit-conf.imec.msu.ru/ )

• http://hit-conf.imec.msu.ru/2012/lectures/Chernyshenko.doc
• http://hit-conf.imec.msu.ru/2006/Template.doc

Search of Novel Crystalline Materials , Study of their Properties and Crystallization Processes . ... The work of group for the search of novel crystalline materials are held at M.V. Lomonosov Moscow State University since 1964. The main aim of investigations are search and study of new promising multifunctional materials with unusual physical properties: ferroelectrics, superionic conductors, nonlinear optical materials, laser crystals, piezoelectrics, etc. ...

107. 2nd Announcement

108. Лаборатория Физико-химической газодинамики

109. http://ideas.msu.ru/docs/Decision_ideas.pdf

110. http://np-chair.sinp.msu.ru/download/epja100510-offprints.pdf

111. http://www.eng.geogr.msu.ru/science/newsletter/12_12.pdf

112. http://belyakov.imec.msu.ru/papers/PhysCon2005.pdf

113. Complex evaluator

114. Lexical Resources for Personal Data Recognition in Texts

115. Кафедра физики элементарных частиц физического факультета МГУ

116. http://cellmotility.genebee.msu.ru/html/articles/jcs.pdf

117. http://iaas.h1.ru/meo.doc

118. http://dynamo.geol.msu.ru/personal/vsz/papers/Lubnina_etal_2015_eng.pdf

119. PARALLEL.RU - Новости, выпуск #318 [27/12/2011]

120. http://www.iisi.msu.ru/UserFiles/File/bayern2009/gorokhov_eng.doc