Papers submitted to QUALICO-94 . ... Anoshkina J.G. Morphological Processor for the Russian Language . ... Baskevich V.M. Statistical Analysis of Lexical Units in Texts of Different Functional Styles) . ... Breiter M.A. Length of a Chinese Word in Relation to its other Systemic Features . ... Kazakevich O.A. Minor Languages of Russian on Computer . ... Moscalenko T.A. Quantitative Analysis of Different Levels Lexical Units Distribution in Legislative Texts: Word forms, Lexemes, Hyperlexemes] . ...

Еще в разделе: (Показать все результаты (>41) - old.philol.msu.ru/ )

• MSU-LGCLL:: Anatoliy A. Polikarpov - Some Factors and Regularities of
• MSU-LGCLL:: Anatoliy A. Polikarpov - Major Tendences in Micro- and
• Melnikov G.P.- Systemology and Linguistic Aspects of Cybernetics

Lunar Base Development Issues, Technology Requirements, and Research Needs Peter Eckart[1] Abstract The development, design, and construction of a lunar base will be an extremely complex technical task. ... Eckart, 1999] Lunar Extra-vehicular Activities (EVAs) & Surface Transportation Systems The definition and development of space suits, portable life support systems (PLSS), and surface transportation systems can draw extensively from experiences gained during the Apollo missions. ...

Еще в разделе: (Показать все результаты (>78) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Symposium/peter.pdf
• http://selena.sai.msu.ru/Greg/Publications/ms38/ms068.pdf
• http://selena.sai.msu.ru/Pug/Publications/ms34/MS058.pdf

International Maize and Wheat Improvement Center No. ... AFRICA "Maize production is likely to suffer the most due to climate change compared to other crops in Southern Africa," said CIMMYT physiologist Jill Cairns, who presented on CIMMYT work under the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) at the FAO Agriculture Coordination & Information Forum in Harare, Zimbabwe, on 25 July 2013. ... Policy makers in the seed value chain must be engaged as well. ... 2013. ...

Еще в разделе: (Показать все результаты (>12) - ecfs.msu.ru/ )

• Topic 2: Barriers to Sustainable Soil Management in Eurasia / Барьеры на пути к

... Welcome to Moscow, Russia . The ICONO/LAT:2013 will be held in Moscow, capital of the Russian Federation, the biggest city in Europe and one of the biggest in the world. Moscow's origin as a symbol of Russia goes back 850 years. ... and your time while in Moscow, are given below. тАв Travel and event guide for Moscow, Russia: . http://all-moscow.ru/moscow.en.html . ... SIGHTSEEING PROGRAM . ... Please contact the travel agency table at the registration area for details. ... Registration . ...

Еще в разделе: (Показать все результаты (>8) - iconolat13.phys.msu.ru/ )

• Invited speakers

... Co-Chairman of the Forum ­ Deputy Secretary of the Security Council of the Russian Federation , Sergey M. BURAVLEV Co-Chairman of the Forum ­ Adviser of the Security Council of Russian Federation , Director of Lomonosov Moscow State University Institute of Information Security Issues, Vladislav P. SHERSTYUK Co-Chairman of the Forum ­ Special Representative of the President of the Russian Official languages: Russian, English. ...

Еще в разделе: (Показать все результаты (>16) - iisi.msu.ru/ )

• http://www.iisi.msu.ru/UserFiles/File/Terminology%20IISI%20EWI/Russia-U%20S%20%20bilateral%20on%20terminology.pdf
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/twomey.doc
• http://www.iisi.msu.ru/UserFiles/File/bayern2009/global_dns.pdf

... 0, Issue 0, 1-8 computing @tneu.edu.ua www.computingonline.net ISSN 1727-6209 International Scientific Journal of Computing SATELLITE IMAGE PROCESSING ON A GRID - BASED PLATFORM Dana Petcu 1), Dorian Gorgan 2), Florin Pop 3), Dacian Tudor 4), Daniela Zaharie 1) 1) 3) Computer Science Department, Western University of Timisoara, B-dul Vasile Parvan 4, 300223 Timisoara, Romania, {petcu,dzaharie}@info.uvt ... MedioGrid: a Grid-based platform for satellite images. ...

Еще в разделе: (Показать все результаты (>18) - angel.cs.msu.su/ )

• http://angel.cs.msu.su/~oxana/image_processing/papers/2009-02370009.pdf
• ExtensionFileFilter
• Appendix B File Format Specification

MSU . Science Park . ... Prototyping center . ... Nowadays MSU Science Park provides office and laboratory premises in the center of Moscow in the close vicinity to the best University in Russia. ... One hundred twenty technological (IT, industrial engineering, medical devices and oil&gas services) companies are the residents of the Science Park. ... Five companies resident in MSU Science Park were listed amongst the top 50 by TechUspekh in their rating of the Top 100 innovative Russian companies. ...

Еще в разделе: (Показать все результаты (>6) - www.sciencepark.ru/ )

• MSU Science Park - Venue & Space

... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>146) - www.genebee.msu.ru/ )

• Screening pattern or alignmemt against PROTEIN databank
• AliComp - GeneBee Alignments Comparison - Advanced
• GeneBee service

... Software . Laboratory of Mathematical Methods of Image Processing . ... Available options: -sigma - (mandatory) set blur parameter for the input image , range: 1.0 to 20.0 - power - set warping power , range: 0.0 to 5.0, default value is 1.0 -1d - apply one-dimensional algorithm (faster but lower quality) basicedges - detect basic edges - edges good for artifact analysis -scale - set scale parameter, range: 1.0 to 20.0, default value is 4.0 gaussblur - blur input ... warp.png . ...

Еще в разделе: (Показать все результаты (>72) - imaging.cmc.msu.ru/ )

Thursday, June 24th, 2010 . ... Wednesday, June 16th, 2010 . На сайт добавлен пакет Lightbox 2.04 (http://www NULL .huddletogether NULL .com/projects/lightbox2/) (by Lokesh Dhakar) для отображения графики с дополнительными визуальными эффектами: . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for June, 2010. ... Наши публикации . ... Публикации за 2011 . Публикации за 2012 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>4) - geo.sai.msu.ru/ )

• Lightbox 2 Лаборатория лазерной интерферометрии
• site lightbox Лаборатория лазерной интерферометрии
• Uncategorized Лаборатория лазерной интерферометрии

VOLUME 86, NUMBER 20 PHYS ICAL REVIEW LETTERS (a) 3200 2400 1600 14 M (b) 2000 1600 1200 800 400 AY 2001 Comment on "Dispersion-Independent High-Visibility Quantum Interference in Ultrafast Parametric Down-Conversion" Recently AtatЭre et al. claimed to "recover" highvisibility quantum interference in femtosecond pulse pumped type-II spontaneous parametric down-conversion (SPDC ) using neither spectral postselection nor a thin nonlinear crystal [1]. ... This is what AtatЭre et al. observed in Ref. ...

Еще в разделе: (Показать все результаты (>76) - qi.phys.msu.ru/ )

• Sergei Kulik: Scientific interest

... Home > Scientific laboratories > IM . ... The Laboratory of Industrial Mathematics (LIM) headed by Professor V.M. Goloviznin was established in the Faculty of Computational Mathematics and Cybernetics (CMC) of Lomonosov Moscow State University in 2011. ... In the area of energy and space, examples of topical engineering problems LIM is involved in, include the numerical simulation of new-generation atomic plants and computational aeroacoustics. ... Source URL: http://en.cs.msu.ru/laboratories/im . ...

Еще в разделе: (Показать все результаты (>82) - en.cs.msu.ru/ )

• Laboratory of Industrial Mathematics | CMC MSU
• Laboratory of Programming Technologies | CMC MSU

... For full UV energy Euv (erg) radiated in TLE the corresponding number of photons of wavelength =300-400 nm (with average energy 3.5 eV) is: Nph=Euv/3.5в1.6 10-12 (1) We considered 2 options of the pinhole camera focal distance: 1. focal distance is short so that the circle of diameter 40 km is observed by one pixel and 2. focal distance is long so that the 40 km circle is observed in many camera pixels. ... Full energy released in UV in the atmosphere is determined by the pixel signal. ...

Еще в разделе: (Показать все результаты (>2) - cosrad.sinp.msu.ru/ )

• http://cosrad.sinp.msu.ru/experiments/tus/doc/HO2COSPAR2006.pdf

Faculty of Physics of Lomonosov Moscow State University . ... Department of Photonics and Microwave Physics is one of the largest departments of Faculty of Physics of Lomonosov Moscow State University . ... Our department holds annual conference on wave phenomena in nonhomogeneous media, physics and applications of microwaves in May in Moscow suburb. ... Physics of microwaves . ... Department of Photonics and Microwave Physics . Faculty of Physics . Lomonosov Moscow State University . ...