Published on Department of the Automation for Scientific Research CMC MSU ( http://ani.cs.msu.su ) . ... Department of the Automation for Scientific Research (ASR) was founded in 1988 on the basis of research and teaching group of the Mathematical Physics Department (former Department of Computational Mathematics). ... Under his guidance the department performs wide spectrum of research in the field of computer simulation of complex systems and processes. ...

Еще в разделе: (Показать все результаты (>6) - ani.cs.msu.su/ )

SVETKA, a program for analysis of different alignments . Back to the help page . ... Such a feature can look like " Leucine in the position 362 of the alignment of the entire family " and can, in many cases, be a "decision rule" to distinguish sequences from two sides of a tree branch. ... Comparing the alignment with an input tree (the tree may be entered by the user or reconstructed with the WPGMA algorithm), the program detects supporting positions of the alignment for every branch the tree. ...

Еще в разделе: (Показать все результаты (>455) - monkey.belozersky.msu.ru/ )

• About authors ot this complex

... Лаборатория углеродных материалов . ... физического факультета МГУ . имени М.В. Ломоносова . 17 ноября 2015г. Поздравляем Редекопа Евгения Владимировича ! ... Углеродных успехов и долгожданных открытий в новом году. 25 декабря 2014г. Запуск нового сайта лаборатории. ... Букунов Кирилл (рук. ... Копытина Татьяна (рук. ... Морозов Максим (рук. ... Ржевский Александр (рук. ... 15 февраля 2014г. Поздравляем Алексеева Андрея с поступлением в аспирантуру Физического Факультета МГУ! ... П. Кос (рук. ...

Еще в разделе: (Показать все результаты (>6) - carbon.phys.msu.ru/ )

• Лаборатория углеродных материалов - Наука

Mailing List . Discussion club . Unresolved problems in the Study of Nature and Evolution of Human Language . ... Our goal is to consider some interesting and still unresolved problems of general theory of Human Language. ... Regularities of Human Language Evolution”. ... Universal, typological and stylistic features of Human Language Evolution; . ... Large Explanatory Dictionary of Russian (SPb: Norint, 1998. - 1536p.): preliminary evoluation of the dictionary (Russian letter "X") . ...

Еще в разделе: (Показать все результаты (>62) - old.philol.msu.ru/ )

• MSU-LGCLL:: Papers submitted to QUALICO-94
• MSU-LGCLL:: Curriculum Vitae of Anatoliy Anatolyevich Polikarpov
• HUMLANG - announcements

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>5) - mouse.genebee.msu.ru/ )

• Align tool for DNA-protein complexes

Young tree of Alnus glutinosa, White Sea coast, August 2004 BRANCH Branch code LEAF .RANK Number of leaf from the base of the terminal branch LEAF .DIST The distance from the base of branch to the base of leaf , mm LENGTH Maximal length of leaf , mm WIDTH Maximal width of leaf , mm D.LOC Location of maximal width , mm TOOTH Length of the ...

Еще в разделе: (Показать все результаты (>163) - herba.msu.ru/ )

• Algologia. Vol.7, No. 3

... Женский клуб . ... Издательство МГУ . ... МГУ им.Ломоносова . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... AGEXPERTT RX CODE - первый антивозрастной продукт специально для мужчин, повышающий физическую, умственную и сексуальную активность, замедляющий процесс старения. ... AGEXPERTT RX CODE - биологически активная добавка к пище для повышения мужской активности и коррекции возрастных изменений. ... В течение многих веков это растение использовалось для повышения потенции и сексуальной силы мужчин. ...

Еще в разделе: (Показать все результаты (>303) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: AGEXPERT SX CODE антивозрастной секс тоник
• Клуб выпускников МГУ: Петр Митричев, победитель Google Code Jam: 'Слава
• Клуб выпускников МГУ: Объявлен победитель Google Code Jam

Home . Database of structures of nucleic acid - protein complexes . ... List of complexes . Pfam families . SCOP families . Interaction classes . ... NPIDB . ... Information on SCOP and Pfam domains detected in protein chains is presented. ... Each family has its own web page with the list of entries that include domains of the family. ... List of SCOP domains occurred in DNA-protein and RNA-protein complexes is organized in tree-like form, according to the SCOP classification. ...

Еще в разделе: (Показать все результаты (>16) - npidb.belozersky.msu.ru/ )

• NPIDB: List of complexes

Summary Progress Report 2010 ­ 2014 UNESCO Chair on Global Problems and Emerging Social and Ethical Challenges for Large Cities and Their Population at the Faculty of Global Processes of the Lomonosov Moscow State University Period of activity: September 2010 June 2014 Title of the Chair : UNESCO Chair on Global Problems and Emerging Social and Ethical ... Visit of UNESCO Director-General Irina Bokova at Moscow State University September 9, 2011. ...

Еще в разделе: (Показать все результаты (>41) - fgp.msu.ru/ )

DNS Security, Stability and Resiliency John Crain Chief Technical Officer April 21st 2009 Garmisch 1 Monday, 20 April 2009 Agenda · The Global DNS SSR Symposium · Problems and Opportunities · Questions? ... The level of awareness with respect to the DNS is very low" ­ All quotes from Symposium Report 7 Monday, 20 April 2009 Problems & Opportunities 8 Monday, 20 April 2009 Problem: · There is a need for training across all sectors of the industry to raise both skills and awareness. ...

Еще в разделе: (Показать все результаты (>14) - iisi.msu.ru/ )

... Russian Pages . CDFE: Home Page . ... Numerical data, graphics, and bibliography . ... description] . Last updated: May 6th, 2014 . ... Last updated: June 15th, 2011 . ... Last updated: . ... Last updated: April 4th, 2015 . ... Last updated: February 25th, 2016 . ... Last updated: September 27th, 2011 . ... Photonuclear Data Index since 1955 . ... Last updated: September 15th, 2015 . ... Last updated: March 22th, 2010 . ... Last updated: March 19th, 2015 . ... Last updated: May 15th, 2002 . ...

Еще в разделе: (Показать все результаты (>20) - cdfe.sinp.msu.ru/ )

• CDFE => Online Services => NSR Search Engine
• CDFE => Online Services
• CDFE => Online Services => Relational ENSDF

... Among them there is forward modeling for uniform anisotropic halfspace to calculate ARS diagrams for different arrays (AM (U), AMN (E), dipole equatorial (D), three-pole (T), Y and Arrow-type (AT) array, etc.), when source of current is on the earth surface or at a depth. All linear arrays (AM, AMN, dipole axial) give anisotropy ellipses with axis ratio equal to anisotropy coefficient, while non-linear arrays (D and others) have this ratio equal to anisotropy coefficient in the 5-th power. ...

Еще в разделе: (Показать все результаты (>54) - geophys.geol.msu.ru/ )

• Researchs
• Page 3. Publications
• Software for resistivity and induced polarization

... With the usage of on-land and satellite altimetrical measurements data some gravity map were made, averaged on one degree trapeziums, in reductions Faja, Bouguer, Glenni, which were included in the geological-geophysical international atlases of Atlantic, Indian and Pacific oceans. ... Boldirev S.A., Gajnanov A.G., Stroev P.A. Dencital inhomogeneities in lithosphere and dynamics of development of the North-West part of the Pacific mobile belt. ... Moscow, Nedra edition, 1967. ...

Еще в разделе: (Показать все результаты (>73) - www.geol.msu.ru/ )

• Department of Lithology and Marine Geology - Laboratories
• Download Yuri Shvarov's files
• "Смирновский Сборник". Кафедра геологии и геохимии полезных ископаемых

... site navigation | footer (site information) . IChO-2007 Participation Problems IChO RUSSIA Sponsors search . ... Moscow-1996 | ... Chemistry Department | ... Homepages of National Competitions Other International Science Olympiads Previous IChO's Miscellaneous Chemistry sites . ... Some fresh information is available. A letter from the President of 39th IChO . ... Information about post-Olympiad tour is now available . ... Information about guides of 39th IChO is now available. ...

Еще в разделе: (Показать все результаты (>2) - icho39.chem.msu.ru/ )