... Петрунин Ю.Ю., Чатаева О.С., Багатырова А.Б. Как можно быть футбольной болельщицей? Проблемы управления: теория и практика . Витальева В.А., Зуб А.Т. Принципы обеспечения эффективности стратегических решений . ... Петрова Е.А., Шевандрин А.В., Калинина В.В. Формирование системы оценки эффективности территориального управления . ... Коммуникационный менеджмент и стратегическая коммуникация в государственном управлении . ... 119991, Москва, Ломоносовский проспект, д. 27, корпус 4, А-701; тел.: ...

Еще в разделе: (Показать все результаты (>21) - e-journal.spa.msu.ru/ )

Sergey Vladimirovich Petrushanko Afflilation and official address: Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow State University Leninskiye Gory, Moscow 119991, Russia E-mail: sergeant@mail.cern.ch Date and place of Birth: 24 March 1975, Sverdlovsk (USSR) Citizenship: Russian Federation Education: 2002 Ph.D. (High energy physics ) Skobeltsyn Institute of Nuclear Physics , Lomonosov Moscow ...

Еще в разделе: (Показать все результаты (>41) - lav01.sinp.msu.ru/ )

• Etapi- Comments 3/1/97

... I feel responsibility for keeping, jointly with the RAS part of Frumkin School, the memory about Frumkin Institute as I observed it in 1980th from inside, and later for many years of cooperation with Theoretical Dept. ... The first attempt to collect some papers and photos was stimulated by celebration of V.G.Levich jubilee in MSU in 2007: . ... In 2007, at MSU session dedicated to Levich, Alexander M Kuznetsov presented a wonderful brief talk about Theoretical Dept, with complete list of staff . ...

Еще в разделе: (Показать все результаты (>56) - electr003.chem.msu.ru/ )

• Veronika K. Laurinavichyute overflow
• RADEN Data Bank
• Спецкурс 'Электрохимическая кинетика'

... This course focuses on main characteristics of the ?life? of academic information (its development and diffusion), and on basic algorithms of data retrieval. ... This course consists of four interrelated areas: theoretical introduction (Internetics and information theory), and practical units including the three pillars of information retrieval services: factual, bibliographic and documentary search. ... Factual search. ... Internet-heuristics strategies: summarizing information retrieval skills . ...

Еще в разделе: (Показать все результаты (>492) - hist.msu.ru/ )

• Antijudaisme, philojudaisme, antisemitisme et tolerance religieuse dans les
• Moscow State University. Faculty of History
• На историческом факультете открылась Международная Летняя школа

... Published: 31 August 2015 . Engineering Physics Laboratory took part in the INNOPROM-2015 on July 8-9 2015 as part of the stand of the Faculty of Physics ( Lomonosov Moscow State University ) at the Rostec Corporation exhibition. ... Engineering Physics Laboratory negotiated with Russian developers and manufacturers of computing and telecommunications equipment, shared experience and understanding of the ways of development of Russian microelectronics, including in terms of import substitution. ...

Еще в разделе: (Показать все результаты (>22) - engineering.phys.msu.ru/ )

• Circuit Diagnostics
• Alexander Monahov
• Georgiy Lukyanchenko

This page is in KOI-8 encoding . 2D inversion results for the VES field data obtained near Sevastoplol (the Ukraine) with the . ... The objective of the survey was to study the lambstone massif (the right-hand part of the cross-section) embedded in the litified clays (the central and the left-hand part of the cross-section). ... According to the geological data, it is likely that the lambstone block forms the landslide body slipping over the water-saturated litified clays. ...

Еще в разделе: (Показать все результаты (>52) - geophys.geol.msu.ru/ )

• TES tecnology 2
• TES. Modeling example.
• TES. Field example.

Универсиада ?Ломоносов? ... Универсиада ?Ломоносов? проводится в целях выявления и поддержки талантливой молодежи, развития творческих способностей студентов, содействия их профессиональному росту, привлечения студентов к продолжению обучения в магистратуре и аспирантуре, повышения результативности выступления талантливых студентов на международных олимпиадах и конкурсах и упрочения связей между Московским университетом и ведущими вузами России, стран СНГ и дальнего зарубежья. ... 31 марта . ...

Еще в разделе: (Показать все результаты (>19) - universiade.msu.ru/ )

... We computed the permanently shadowed areas and temperatures inside the craters for the variation of the position of the lunar pole of rotation with respect to the ecliptic pole with a period of 18.6 years. ... According to our results, the total permanently shadowed area in the polar craters of the Moon is equal to 50428.7 km2, or 0.13% of the total area of the lunar surface [3]. ... The area of permanently shaded part of a crater makes 59 % from all area of a crater [3]. ...

Еще в разделе: (Показать все результаты (>75) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Rod/Publications/ms40/56_Lasarev_Radionova.pdf
• http://selena.sai.msu.ru/Chik/Publications/Aitken/MS015.pdf
• http://selena.sai.msu.ru/Symposium/South%20Pole.doc

... February, 2006 . ... Moscow State University Russian Language Centre . Moscow State University . ... Learn Russian at the Moscow State University! On Friday, on February, 17th, in the Boardroom of the Academic council of the Moscow State University with lecture Minister for Foreign Affairs of Kingdom Norway mister Junas Gar Styore has acted. (more.. ... In the first days of March students of the center celebrated an ancient Russian holiday Maslenitsa (pancake week). ...

Еще в разделе: (Показать все результаты (>6) - www.rlcentre.com/ )

• "ABOUT RUSSIAN" - журнал о русских людях и их языке

F1 ATPase NANO MOLECULAR MOTOR DYNAMICS DIPLOMA THESIS ABSTRACT Bulushova L.S. F0F1 ATPase nano-mo lecular motor dynamics is analyzed in the present paper. This nanomo lecular motor converts chemical energy into rotation energy of rotor ( subunit)­ the main part of F0F1 ATPase or vice versa. F1 ATPase is a part of the motor and it can work and transform energy independent ly. ... Kinemat ic links between an angle of the rotor turn and subunit closure angle are achieved. ...

Еще в разделе: (Показать все результаты (>32) - ofvp.phys.msu.ru/ )

• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Vorobiev_Savelev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Parschuk_Chikishev_en.pdf
• http://ofvp.phys.msu.ru/en/science_education/diploma/annot/2006/Rykovanov_Platonenko_en.pdf

Academic English Part 4 of 4 Sources: 1. ... Cambridge University Press Unit After · · 51 completing the tasks the students will: Learn about US system for higher education in science Learn some communicative strategies they might use when asking for help or information from colleagues · Learn to write a CV and participate in an interview · Revise their reading strategies · Revise their summarizing strategies Camb 1. 2. 3. 4. ridge English for Scientists, Unit 1, pp.6-7 all ...

Еще в разделе: (Показать все результаты (>20) - www.eng.math.msu.su/ )

• http://www.eng.math.msu.su/download/Academic_English_part2.pdf
• http://www.eng.math.msu.su/download/Academic_English_part3.pdf
• Образец - Кафедра английского языка механико-математического факультета МГУ им.

... Faculty of Basic Medicine, Lomonosov Moscow State University and State Research Center ­ Institute for Biomedical Problems, Russian Academy of Science invite you to take part in "VI Russian National School with International Participation on Muscle and Exercise Physiology "Systemic and cellular mechanisms in physiology of motor system". ... We invite scientists, post-grade students, residents and students to take part in School on systemic and cellular mechanisms in physiology of motor system. ...

Еще в разделе: (Показать все результаты (>2480) - fbm.msu.ru/ )

... 2006, . ... 424-436 Rybakov A. A. at al -- MCE -- 2006, v. 2, p. 424-436 , , . ... Mathematical Models In Biology, Ecology And Chemistry ek ( e k *e j = k j ) (1). ek ( ), . ... Phys. --1989. Vol. ... Amitrano C., Berry R.S. Probability distributions of local Liapunov exponents for small clusters // Phys. Rev. Lett. ... Chaotic behavior of triatomic clusters // Phys. Rev. A. -- 1997. ... Yurtsever E. Angular-momentum-driven chaos in small clusters // Phys. Rev. A. -- 1998. ...

Еще в разделе: (Показать все результаты (>16) - beams.chem.msu.ru/ )

... Conserved factor . Compensated factor . Cluster factor . ... Part of sequence . ... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . ... Alignment OR sequence (without name). ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>154) - www.genebee.msu.ru/ )

• Импакт фактор научных журналов в 2003 году
• Impact Factors of Scientific Journals in 1999
• No title

... Subject to the MOIP Charter both natural and legal persons may become the members of the Society upon paying admission fees and acknowledging the Charter and program documents. ... Persons may be elected as the Society?s full and corresponding members on a show of hands at the Society?s Council (Presidium) meeting if nominated by a section and recommended by at least two full Society?s members. ... The Society?s full members have the following rights: . ... 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>4) - www.moip.msu.ru/ )

... A.V. Chetvertukhin, M.I. Sharipova, A.G. Zhdanov, T.B. Shapaeva, T.V. Dolgova, and A.A. Fedyanin . ... A. I. Musorin, P. V. Perepelkin, M. I. Sharipova, A. V. Chetvertukhin, T. V. Dolgova, and A. A. Fedyanin . ... Margarita I. Sharipova, Alexander I. Musorin, Tatyana V. Dolgova, Andrey A. Fedyanin . Ultrafast dynamics of Faraday rotation in thin films" . ... Sharipova M.I., Musorin A.I., Dolgova T.V., Inoue M., Fedyanin A.A. "Ultrafast Dynamics of Faraday Rotation in Magnetophotonic Crystals" . ...

Еще в разделе: (Показать все результаты (>40) - nanolab.phys.msu.ru/ )

• Research | Laboratory of Nanophotonics & Metamaterials

Comprehensive comparison of RNA-seq based methods for differential splicing analysis G. Speshilov IITP RAS, Bolshoy Karetny per. 19, build.1, Moscow, 127051 Russia, gspeshilov@kirby.unsw.edu.au Post-transcription maturation of many eukaryotic mRNAs requires splicing: removal of some parts of pre-mRNA called introns and joining of remaining parts called exons. ... Strikingly, even in absence of differential expression, results of these best-performing methods exhibit very low agreement. ...

Еще в разделе: (Показать все результаты (>82) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/243.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/165.pdf
• http://mccmb.belozersky.msu.ru/2013/abstracts/abstracts/157.pdf

Клуб выпускников МГУ (Московский Государственный Университет) . ... How to prevent free radical damage by creating superior cellular health with THIS important nutrient.. The most important part of your cell that you should be nourishing (and it is NOT the nucleus)...and so much more! Страница сайта http://www.moscowuniversityclub.ru . Оригинал находится по адресу http://www.moscowuniversityclub.ru/home.asp?artId=12524 . ...

Еще в разделе: (Показать все результаты (>4405) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: КАК ОБОСНОВАТЬСЯ В КАНАДЕ: ПЕРВЫЕ ШАГИ (часть 11)
• Клуб выпускников МГУ: Oklick - официальный партнер УЦ ВМК МГУ Academy
• Клуб выпускников МГУ: Канадцам официально разрешили лечиться каннабиоидами

... Low resolution protein structures . ... Computational models partly based on experimental data . ... protein domain . ... Ribosomal L11 protein in complex with thiostrepton and a 23S rRNA fragment . ... Ternary complex formed between MarA, the alpha-CTD of RNA polymerase and DNA . ...

Еще в разделе: (Показать все результаты (>32) - monkey.belozersky.msu.ru/ )

• HTH3_HBonds
• HTH_3_main
• About authors ot this complex

... Air temperature in the forechamber: 285-295K . ... Aerodynamic unit AR-2 is used for experimental research of heat and mass exchange processes in a model boundary layer, flown over by supersonic air stream. The main part of the unit is supersonic aerodynamic tube of continuous action with regulated plate nozzle, rectangular cross-section of the working part 100x70 and with regulated exit cone. ... Unit AR-2 is a supersonic aerodynamic tube with a regulated supersonic nozzle and an exit cone. ...

Еще в разделе: (Показать все результаты (>6) - termogaz.imec.msu.ru/ )

• subsonic dimples_e
• AR-3main_e
• A-11main_e