... Geography of World Economy . ... Departments . About Faculty . ... Field stations . ... Type of field courses . ... Department of Geography of World Economy . Department of Landscape Geochemistry and Soil Geography . ... Department of Oceanology . ... Department of Social-Economic Geography of Foreign Countries . ... In particular, the Dean of the Faculty and the Heads of Departments have a direct responsibility for the efficient running of academic departments. ... DEPUTY DEAN FOR RESEARCH . ...

Еще в разделе: (Показать все результаты (>5) - www.eng.geogr.msu.ru/ )

• Undergraduate study
• Selenga-Baikal research

Space Weather . ... Models . Data . ... Space Weather Analysis Centre of SINP MSU provides information about the current state of near-Earth's space. Information Services ( SWX ) on the website of the center provide access to current data describing the level of solar activity, geomagnetic and radiation state of the magnetosphere and the heliosphere in the real time. For data analysis, the models of the space environment, working in off-line as well as on-line mode have been implemented. ...

Еще в разделе: (Показать все результаты (>17) - swx.sinp.msu.ru/ )

• SWX - О проекте
• SWX - Данные

... Vladimir Ivanovich . ... M.V.Lomonosov Moscow State University, . 119991 Moscow, Russian Federation . ... Department of Chemical Enzymology, Faculty of Chemistry, M.V. Lomonosov Moscow State University, Moscow, Russian Federation . ... Faculty of Chemistry, M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ... Professor, Head of the Laboratory of Genetic Engineering and Protein Design - Faculty of Chemistry , M.V.Lomonosov Moscow State University, Moscow, Russian Federation . ...

Еще в разделе: (Показать все результаты (>202) - www.enzyme.chem.msu.ru/ )

• Web-site of graduates from Chemistry Faculty of Moscow State University in 1980
• PubMed medline query
• Group of microbial biochemistry and biotechnology

Cellular automata is a set of cells. Each cell can be in one of several possible states. Cell can change its state, according to state of neighbors of the cell. ... Cyclic cellular automata is a kind of cellular automata, its set of states is a cycle, and cell changes its state to next one, according to cycle order. ... Other options are automata step duration, scale of field, colors of cell in defferent states. ... Clean field converts all cells in first state of automata list of states. ...

Еще в разделе: (Показать все результаты (>2101) - kodomo.cmm.msu.ru/ )

• Changeset 69:ac96d7c2c7c4 ? Cyclyc Cell Automata
• Changeset 29:315a5fdf099e тАУ Cyclyc Cell Automata
• state.py тАУ Cyclyc Cell Automata

... diff . ... state_list change handlers and fill of entries . ... 1.1 --- a/ Interface.py Tue Dec 07 16:05:28 2010 +0300 1.2 +++ b/ Interface.py Wed Dec 08 02:33:39 2010 +0300 1.3 @@ -194,41 +194,67 @@ 1.4 self.draw() 1.5 1.6 def to_top(self):# replace choosen state to top 1.7 - index = automata.symbols.get( state _list.get( active ).split()[0]) 1.8 - state = automata.states [ index ] 1.9 - del automata.states [ index ] 1.10 - automata.states.insert(0, state ) 1.11 - state _list.delete( ...

Еще в разделе: (Показать все результаты (>7267) - kodomo.fbb.msu.ru/ )

• cca: dd3e42d72f44
• cca: eef739e055f4 State.py
• cca: 315a5fdf099e

For the hearing protection of the "Mir" station crew the headphones with active noise reduction were used. ... Our full acoustic tests of the complete headset have shown that the factors of noise reduction are the following: . The passive noise reduction is about 20dB in the range 500Hz – 10kHz and it has been archived with the aid of special form and materials with sound insulation properties. ... Besides it is necessary to build an output to the station communication systems in the headphones. ...

Еще в разделе: (Показать все результаты (>110) - www.intsys.msu.ru/ )

• Intelligent Systems :: Staff :: Gasanov Elyar Eldarovich
• Intelligent Systems :: Magazine
• Intelligent Systems :: Staff :: Babin Dmitry Nickolayevich

W e are happy to greet you, young people who have decided to devote themselves to studying the fundamental laws of nature in all their manifestations ranging from tiny particles of the microworld to the infinite depths of megaspace! Lomonosov Moscow State University is the first University of Russia and one of the leading Universities of the world. T he system of higher physics education at our faculty has been universally recognized. ... Faculty of Physics Dean . ...

Еще в разделе: (Показать все результаты (>41) - foroff.phys.msu.ru/ )

• Key research directions
• A GLIMPSE BACK INTO THE HISTORY
• Map of the Campus

Dmitry Karpov . Dmitry Karpov was born in Moscow, Russia. ... Dmitry Karpov studied mechanisms of formation of the valence band in the water Raman Scattering (RS) spectrum. In particular, he focused on (1) the effect of the ion hydration type change due to the temperature variation on the valence band shape in the water RSS and (2) the study of the Fermi resonance role in the formation of the valence band in the water RSS by using the RS temperature dependence. ...

Еще в разделе: (Показать все результаты (>41) - rswater.phys.msu.ru/ )

• Laboratory of laser spectroscopy of solutions of supramolecular compounds and
• Sergey Burikov
• Tatiana Dolenko

Chemistry Department - Lomonosov Moscow State University . Inorganic Chemistry Division . Home . ... Division Colloquia . ... Inorganic Materials Sciences . Chemistry of Coordination Compounds . Inorganic Synthesis . Inorganic Crystallochemistry . Chemistry and Physics of Sensor and Semiconductor Materials . ... Inorganic Chemistry Division, Department of Chemistry, . Moscow State University, . ... 119991, GSP-1, Moscow, Russia . 7-(495)-939-2074, +7-(495)-939-0998 . ...

Еще в разделе: (Показать все результаты (>111) - www.inorg.chem.msu.ru/ )

• Joint Semiconductors Surface Study group
• Prof. B.A.Popovkin Memorial page
• Inorganic Synthesis Laboratory people

Next: Sample Program Up: Guided tour through MICO Previous: Objects in distributed systems . MICO is a fully compliant CORBA 2.2 implementation. ... Dynamic Invocation Interface (DII) . ... full BOA implementation, including all activation modes, support for object migration, object persistence and the implementation repository . ... event service . ... Our goal is to keep the core of MICO fully compliant to the latest version of the CORBA specification, while integrating new CORBA services. ...

Еще в разделе: (Показать все результаты (>394) - rtm-cs.sinp.msu.ru/ )

• Qt Toolkit - QMouseEvent Class
• Qt Toolkit - QKeyEvent Class
• Qt Toolkit - tictac/tictac.cpp example file

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

... The SNMP Trap messages are divided into 2 groups: generic and specific. ... The following defines the generic traps together with the values of their respective 'generic' and 'specific' fields: COLDSTART TRAP Cause: issued upon power-up. ... Generic field: 2 Specific field: reason (bits 30-31) 0 = scheduled 1 = link error 2 = indeterminate 3 = frame reject state information (bits 0-23) LINKUP TRAP Cause: issued after a network link interface (LAPB) has been declared up. ...

Еще в разделе: (Показать все результаты (>16735) - mirror.msu.net/ )

• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/pdfrfc/rfc795.txt.pdf
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc795.txt
• http://mirror.msu.net/pub/rfc-editor/rfc-ed-all/rfc6608.txt

... MSU Chamber Orchestra . ... Concerto МГУ . ... Georg Fridrich HANDEL . ... May 1 (Sunday), 6.00 p.m. Baptist Church in Zelenograd. buses 9, 11 or taxi 131 from metro station 'Rechnoj vokzal'. tel. ... May 2 (Monday), 6.00 p.m. Moscow Baptist Church 'Resurrection'. metro station 'Kashirskaja', Kashirskoe shosse, 70, bld. 2. tel . ... May 4 (Wednesday), 7.00 p.m. The 2 nd Moscow Baptist Church. metro stations 'Tulskaja' or 'Nagatinskaja', Varshavskoe shosse, 12 А . ... MSU CHAMBER ORCHESTRA . ...

Еще в разделе: (Показать все результаты (>24) - music.genebee.msu.ru/ )

THE LABORATORY OF CHEMISTRY AND PHYSICS OF SENSOR AND SEMICONDUCTOR MATERIALS . Dr., Prof. Vladimir P. Zlomanov . e-mail: zlomanov @inorg.chem.msu.ru . ... RAS scientific boards member in directions "Physicochemical foundations of semiconductor material science" and "High-purity substances chemistry" . ... С.Г.Дорофеев, А.А.Винокуров, О.И.Тананаева, Т.А.Кузнецова, В.П.Зломанов. ... 2006, 42(9), 1057. ... 2008-2010 The Laboratory of chemistry and physics of sensor and semiconductor materials. ...

Еще в разделе: (Показать все результаты (>63) - www.lssm.inorg.chem.msu.ru/ )

• The Laboratory of chemistry and physics of sensor and
• The Laboratory of chemistry and physics of sensor and semiconductor materials

Ionization Dynamics of Atoms Exposed to Strong Laser Pulses: Semi­Analytical Model at Low Field Frequencies Yu.V. Popov Skobeltsyn Institute of Nuclear Physics, Lomonosov Moscow State University Collaboration B. Piraux, A. Hamido. ... INTRODUCTION AND MOTIVATIONS Keldysh has introduced the adiabaticity parameter = (2Ip)1/2/E where is the laser field frequency, E, the field amplitude, and Ip the ionization potential of the atom. ... Both of them, multiphoton processes and tunnel ionization play a role. ...

Еще в разделе: (Показать все результаты (>12) - lmmqsp.sinp.msu.ru/ )

• http://lmmqsp.sinp.msu.ru/mat/poster_neutrino_2013.pdf
• Laboratory of Mathematical Models of Quantum Scattering Processes / MSU

... Department of Chemistry . Structure of the Chemistry Department . Physical Chemistry Division . Chemistry resources in the Internet . MSU Main Server . MSU Servers . ... about laboratory | ... Copyright 2001, Laboratory of Catalysis and Gas Electrochemistry, Web-design A.N. Kharlanov. ... Last updated 20 April 2001 . ...

Еще в разделе: (Показать все результаты (>32) - www.kge.msu.ru/ )

• Russian Universities
• Scientific equipment of laboratory
• ЛОКТЕВА ЕКАТЕРИНА СЕРГЕЕВНА

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>12) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

The effect of chromosome -nuclear envelope attachments on 3D genome organization Nick Kinney, Alexey Onufriev, Igor Sharakhov Genetics Bioinformatics and Computational Biology, Virginia Polytechnic Institute and State University, Blacksburg , VA 24060 , nak3c@vt.edu Department of Computer Science, Virginia Polytechnic Institute and State University, Blacksburg , VA ... A simple lattice model is used to explain why Chr-NE attachments induce these changes in our computational nuclei. ...

Еще в разделе: (Показать все результаты (>247) - mccmb.belozersky.msu.ru/ )

• http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/42.pdf
• MCCMB'15
• MCCMB'13

... California Department of Education (1985), Mathematics framework for public schools, kindergarten through grade twelve. ... California Department of Education (1992), Mathematics framework for California public schools, kindergarten through grade twelve. ... California Department of Education (February 5, 1998), The California mathematics academic content standards. [ http://www.cde.ca.gov/board.html ] . ... NCTM (1998), California mathematics academic content standarts for grades K-12. ...

Еще в разделе: (Показать все результаты (>694) - www.nature.web.ru/ )

• В пустыне будет построена еще одна марсианская станция
• Научная Сеть - Scientific Network
• Секретный американский груз выведен на орбиту