... Alignment Sequence . Include picture . No Picture Only Structure Structure and BP numbers Structure and Stem Energy Full Picture . Sequence name . Alignment OR sequence (without name). The usage of Alignment is strongly recommended. Alignment example: . ... ANMF CGCGGGGTAGAGCAGCCTGGTAGCTCGTCGGGCTCATA AQTRNF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAA BGTRF GCC-AGGATAGCTCAGTTGGTAGAGCAGAGGACTGAAT ANMF ATCCTCTCCCCGCC---- AQTRNF ATCCGCCTCCCGGCACCA BGTRF ATCCGCCTCCCGGCACCA . ...

Еще в разделе: (Показать все результаты (>223) - www.genebee.msu.ru/ )

• FASTA format description
• GeneBee BLAST 2.2.22+ Services Help
• GeneBee BLAST 2.2.8 Services Help

General Information . ... Symposium expenses . ... Presentation information . ... Travel information . ... 14 European Symposium on . Gas Phase Electron Diffraction . ... From metro station "Belorusskaya" (green line) travel to metro station "Teatral'naya" (green line). ... From metro station "Paveletskaya" (green line) travel to metro station "Teatral'naya" (green line). ... After that make a change to "Biblioteka imeni Lenina" (red line) and travel on to metro station 'Universitet' (red line). ...

Еще в разделе: (Показать все результаты (>6) - ged.chem.msu.ru/ )

T.V. Tyupikova, V.N. Samoilov The automated networks of management of financial activity, the control and the account of databases of economic divisions Joint Institute for Nuclear Research. ... Now let's consider concepts "an elementary object" and "a conditional unit of the information" with reference to systems of the analysis and management of the financial and economic activity of anthe enterprise. ... The address part of the elementary object is the number of the account (or of the subaccounts). ...

Еще в разделе: (Показать все результаты (>54) - acat02.sinp.msu.ru/ )

• http://acat02.sinp.msu.ru/presentations/severyanov/Severyanov-poster.ps
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-06-ResourceManagement1.pdf
• http://acat02.sinp.msu.ru/presentations/GGtut/Dev-05-Communication1.pdf

STRUCTURE OF MATTER L. I. SARY CHEV A A short description of the main working particle accelerators used in experimental studies of the structure of elementary particles is given. ... 1 2 * * E 1 + E 2 E , .., 2000 www .issep.rssi.ru © .. ... PS SpS, 315 . ... SpS, , LEP ­ - . PS, SpS, LEP) 100 . ... LEP/LHC . ... d = = 2 sin d. d / d . ... 1918­1988) , (. 2). , , . ... s = g s / ( c ) 15. - ( = 100­300 /), q2 , q2: 2 1 2 s ( q ) ------------------------2 2 ln ( q / ) 1. 116 , 6, 2, 2000 s < 1, . ...

Еще в разделе: (Показать все результаты (>147) - nuclphys.sinp.msu.ru/ )

• http://nuclphys.sinp.msu.ru/mirrors/1997_11.pdf
• http://www.pereplet.ru/nauka/Soros/pdf/9709_071.pdf
• http://nuclphys.sinp.msu.ru/conf/lpp14/210809/MANGAZEEV.pdf

... Next Routine] [List of Routines] NAME: ADD_HEADER PURPOSE: addition information from FITS-headers MPFS-frames DESCRIPTION: The function computes the total exposure, mean value zenit distance and modified FITS header CALLING SEQUENCE: Result =ADD_HEADER( headers ) CATEGORY: reduction MPFS-data INPUTS: Headers = String array FITS-headers from the MPFS data OUTPUTS: Header = String array containing the header from the FITS file. ... OPTIONAL INPUT KEYWORD PARAMETERS: BEFORE = Keyword string name. ...

Еще в разделе: (Показать все результаты (>48) - sn.sai.msu.ru/ )

... education . ... Functional Nanomaterials . ... Composite Nanomaterials Master?s Program . ... admission in January 2010 . ... MSU Faculty of Chemistry announces a new Master?s Program in Composite Nanomaterials, 510500 Chemistry. The program is under the aegis of MSU Nanotechnology Education and Research Center. ... The program is aimed mainly at graduates and young scientists, including Candidates of Science, in chemistry or physics (additional higher education.) ...

Еще в разделе: (Показать все результаты (>26) - nano.msu.ru/ )

• Structure/microstructure and their interplay in nanomaterials and layered
• Composite Nanomaterials Master?s Program | MSU Nanotechnology Education and

Lomonosov Moscow State University . ... Academic Programs . ... Academic Departments Programs . ... Russian Language Program . ... There is a well-known fact that if one doesn't know any foreign languages, he has no notion about his mother tongue. ... Moreover, the academic content is connected with the creation of texts in the Russian language relevant to a plan of a speaker and a writer. ... Address: MSU, Faculty of Foreign Languages and Area Studies, Russia, 119192, Moscow, 31/1, rooms 234-235 . ...

Еще в разделе: (Показать все результаты (>89) - ffl.msu.ru/ )

• International Students
• Иностранным гражданам

Legendre singularities and implicit ODE Vladimir Zakalyukin Moscow State University, Moscow, 119991, Russia e-mail: zak@k804.mainet.msk.su The classification of singularities of first order implicit differential equations in one variable due to A.Poincare, M.Chibrario, V.Arnold, J.W.Bruce, A. Davydov, and others is a famous application of singularity theory. ... A version of the notion of an implicit equation called web is of interest in physics and geometry. ...

Еще в разделе: (Показать все результаты (>23) - pont2008.cmc.msu.ru/ )

... Stanley Milgram SIX DEGREES OF SEPARATION OR SMALL WORLD PHENOMENON 1998, Small world networks Steven Strogatz Duncan Watts Laszlo Barabasi and Reka Albert 1999 In 1999 American physicits Barabasi and Albert have shown that distribution of nodes by the number of links in tke most real networks is described by power law and they called such networks as scale-free networks Reprinted from Linked: The New Science of Networks by Albert-Laszlo ... Human disease network. ... disease ­ , ). ...

Еще в разделе: (Показать все результаты (>7) - www.soc-phys.chem.msu.ru/ )

... A Brief History of Chernogolovka . The scientific center of the Academy of Sciences was founded in 1956 near the village of Chernogolovka, located 20 km north of the town of Noginsk (formerly Bogorodsk, before 1781 - Rogozhi). ... As a town of ancient Moscow, the ancient settlement of Chernogolovka was founded along the old road which connected Suzdal', the capital of East Russian Lands, to Smolensk, the capital of West Russian Lands. ... History of Chernogolovka (in Russian). ...

Еще в разделе: (Показать все результаты (>9) - www.issp.ac.ru/ )

... Supercomputing Technologies in Science, Education and Industry Almanac Series . ... Octotron: Active Control for Reliable Functioning of Supercomputers . ... Detection of all damage/failure sources which may occur within supercomputer or data center; . ... Key feature of the Octotron system is representing the supercomputer functioning model in the form of expanded multi-graph. ... Research Computing Center (RCC) of Lomonosov Moscow State University . ... Excursions to Supercomputing Center . ...

Еще в разделе: (Показать все результаты (>42) - hpc.msu.ru/ )

• APPLICATIONS: Inorganic Chemistry | Moscow University Supercomputing Center

... MASTER Net is 56 square degrees per 1 exposition . ... 06 Dec 2015: GRB 151205B: MASTER-NET early optical observations GCN18665 . ... 18 Nov 2015: GRB 151118A: MASTER-NET optical observations GCN18613 . ... 12 Nov 2015: GRB 151112A: MASTER-NET optical limit GCN18591 . ... 07 Nov 2015: GRB 151107A: MASTER-NET optical observations GCN18565 . ... 31 Oct 2015: Five OTs detected by Global Robotic MASTER Net ATel8232 . ... 02 Oct 2015: GRB 151001B: MASTER-NET early optical observations GCN18380 . ...

Еще в разделе: (Показать все результаты (>211) - observ.pereplet.ru/ )

Beck R., Frick P., Stepanov, R., Sokoloff D. Recognizing magnetic structures by present and future radio telescopes with RM Synthesis, Astron. Astrophys., 543, A113, 2012. ... Aims: We investigate whether the method of wavelet-based RM synthesis can help us to identify structures of regular and turbulent magnetic fields in extended magnetized objects, such as galaxies and galaxy clusters. ... Results: We present observational tests to recognize magnetic field structures. ...

Еще в разделе: (Показать все результаты (>110) - srcc.msu.ru/ )

• Kazakevich, Olga. Endangered Languages Documentation and Description: Should
• Rafaeva, Anna. Description of Propp's Roles in Russian Magic Folktales
• Kazakevich, Olga. Documentation and description of the Northern Selkup local

... Linguistic expeditions . ... Logical and stylistic aspects of lexical semantics . ... Linguistic phenomena can be approached and described from various perspectives. ... The approach proposed here is distinctive in that it is based on logic and stylistics, which are usually considered marginal to the description of linguistic phenomena. ... A special focus in the present approach on parallel texts is directly connected with translation . ...

Еще в разделе: (Показать все результаты (>21) - lcl.srcc.msu.ru/ )

. How could I not image this beauty. Some kids from a Jr. High School in Kansas called me last night with their "discovery" and it sure was a let down to explain to them that it was just nabbed by an automated 30" telescope. How sweet it would have been if it was their discovery! . So it goes. Mike Schwartz , Director . Tenagra Observatories , Ltd. Cottage Grove, OR 97424 . Back to Bright Supernovae . David Bishop Last modified: Sat Jun 5 12:19:23 EDT 1999

Еще в разделе: (Показать все результаты (>22) - www.rochesterastronomy.org/ )

• Supernova 1999dk in UGC 1087
• Supernova 2001ba in ESO 439-G18
• Supernova 2001ck in UGC 9425

... Nature Structural and Molecular Biology [Nat Struct Mol Biol] . Common information . ... since 1994-01-01 till today . ... biology ->cell biology . ... Before 2004 year called [Nature Structural Biology]. ... Nature Publishing Group . ... http://www.nature.com/nsmb . ... http://elibrary.ru/title_about.asp?id.. ... 1994-01-01 . today . ... http://www.nature.com/nsmb/archive . ...

Еще в разделе: (Показать все результаты (>72) - journals.genebee.msu.ru/ )

... Society . ... Library . ... Public Lecture Hall . In the course of science popularization program MOIP shall set up a project called ?Public Lecture Hall?. ... Digitization of the MSN library . We are working on the restoration and digitaziation of the Moscow Naturalist Society library. This will allow to avoid readers? direct contact.љ This will allow to avoid readers? ... In October 2015, the Society?s members, . 2015 Moscow Society of Naturalists . ...

Еще в разделе: (Показать все результаты (>6) - www.moip.msu.ru/ )