Grid Information Service (Meta-Directory Service 2) Globus ToolkitTM Developer Tutorial The Globus ProjectTM Argonne National Laboratory USC Information Sciences Institute http://www.globus.org/ Copyright (c) 2002 University of Chicago and The University of Southern California. ... GIIS requests information from GRIS services as needed. Client 3 GIIS Cache contains info from A and B 5 March 25, 2002 Globus ToolkitTM Developer Tutorial: MDS-2 MDS-2 Service Architecture ? ...
[
Текст
]
Ссылки http://acat02.sinp.msu.ru/presentations/GGtut/Dev-08-Information1.pdf -- 940.6 Кб -- 06.07.2002 Похожие документы
. If you see this page, the nginx web server is successfully installed and working on Debian. Further configuration is required. For online documentation and support please refer to nginx.org . Please use the reportbug tool to report bugs in the nginx package with Debian. However, check existing bug reports before reporting a new bug. Thank you for using debian and nginx.
... Custom Query . ... Component . ... automata io requirements ui . ... And љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . Or љ Blocked By Blocking Cc Component Created Description Keywords Milestone Modified Owner Priority Reporter Resolution Status Summary Ticket Type . ... Summary Component Milestone Owner Type Status Priority Resolution Created Modified Blocked By Blocking Reporter Keywords Cc . ...
List of publications . ... Moscow University Press. 160 pp. ... Shevchenko V.V. A Lunar Base. Moscow. ... Shevchenko V.V., Chikmachev V.I. Lunar Base - a Project of XXI Century. ... Shevchenko V.V., Pugacheva S.G., Dehktereva K.I. Brightness Characteristics of the Infrared and Visible Radiation of the Lunar Surface. ... Problems of Complex Research of the Moon. ... Solar System Research. ... Baydal G.M., Sizentzev G.A., Sotnikov B.I., Shevchenko V.V. Lunar Base Infrastructure and Lunar Resources. ...
... ВШБ МГУ - школе . ... Japanese Expert Takes a Stab at Moscow Traffic . ... Former Japanese Prime Minister Yukio Hatoyama faced the prospect of being stuck in Moscow rush-hour traffic perhaps for hours after his plane landed late at Domodedovo Airport. ... The presentation of a new book by Hatoyama's son on how to solve Moscow's traffic jams. The book, "Moscow: Traffic Problems of a Megalopolis," does not suggest a police escort as a solution to the city's cataclysmic traffic problems. ...
... OK ======================================= To compile CompHEP input make command ======================================= make # command output : ****************************************************************** * CompHEP -4.4p3 has been successfully built * * * * Please create a user working directory using the command * * make setup WDIR=path_to_your_user_work_dir * * NOTE: Do not use '~' to refer to home ... CompHEP-interfaces-1.0.1 has been installed successfully!! ...
Schools of Philology, Psychology, and of the Arts, Moscow State University held 1-3 October, 2010 an international conference entitled . FREE VERSE AND FREE DANCE: EMBODIED SENSE IN MOTION . ... In addition to paper sessions and thematic round-table discussions, the conference included master classes in free dance & musical movement training, sessions of vers libres, sound poetry, dance and contact improvisation, and site-specific performances. All master classes were open for participants. ...
... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...
[
Текст
]
Ссылки http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/poster_mccmb_2011.pdf -- 225.5 Кб -- 21.07.2011 Похожие документы
The abstract must not exceed one page. The electronic version must be sent to gertsens@imec.msu.ru . Abstract example . ... Paper example . Для выпуска сборника тезисов просьба выслать до одной страницы текста, предпочтительно набранного в формате Word со следующими параметрами: . Основной текст - Times New Roman Cyr, размер шрифта - 10. Название - Times New Roman Cyr, полужирный, буквы заглавные, размер шрифта - 11. ... Материалы следует выслать по адресу: gertsens@imec.msu.ru ...
Improved gene annotations for microarray based identifications of reporter metabolites in recurrent breast cancer. ... Here we present an integrated analysis of gene expression measurements from different experimental conditions and different microarray types and versions to investigate reporter metabolite changes of such residual cells, as well as to compare their gene expression profiles. ...
[
Текст
]
Ссылки http://mccmb.belozersky.msu.ru/2015/proceedings/abstracts/171.pdf -- 123.9 Кб -- 15.06.2015 Похожие документы
Analysis of the ANTARES data for SN neutrino detection V. Kulikovskiy (MSU / INFN Genova) Hit counts in the detector. The number of hits ( hit counts ) in a time slice (104.8 ms) is used (this information is stored in each run) Mean number of hit counts in one PMT is ~5500 (corresponds to ~55 kHz) Expected number of hits from SN in 100ms is 11.6 ( 550 0) Bioluminescence bursts should be excluded Bioluminescence cut We have collected distributions of hit counts for each ...
... Multi-threaded search engines . ... Unfortunately, most documents on search engines I saw in the Internet were either lists of hyperlinks without any comments, or discussions about how many documents are in the database of ... (here is the name of a search engine) and what method of counting of the number of documents was used. No words about the efficiency, i.e. how many documents on some subject I can find using this search engine, especially in comparison with the other ones. ...
... Copyrightї1997 Bob Yen (byen@ix.netcom.com) (http://www.comet-track.com/hb/hb.html) . ... Information on Comet Hale-Bopp for the Non-Astronomer Hale-Bopp rotates about twice a day (3/14/97) . ... The Comet Observation Home Page was been selected to receive the Griffith Observatory Star Award for the week of February 2 - 8, 1997 for excellence in promoting astronomy to the public through the World Wide Web. ... Typically, about 1,000 individual users/computers access this page every day. ...
... Winner of joint DAAD (German Academic Exchange Service) and Moscow State University Scholarships Program ?Vladimir Vernadskii? for joint research in Germany. 2011-present. ... 16.11-12.12.2009, Collaborative Research Center 701 of Bielefeld University, Bielefeld, Germany. ... Another ham sandwich in the plane? (joint work with Alexey Balitskiy and Roman Karasev from Moscow Insitute of Physics and Technology), November 9, 2013, Kolloquium Kombinatorik, TU Ilmenau, Ilmenau, Germany. ...
Научная Библиотека . Отдел Обслуживания Физического Факультета МГУ . ... Nature . ... Nature Clinical Practice Cardiovascular Medicine . Nature Clinical Practice Endocrinology & Metabolism . Nature Clinical Practice Gastroenterology and Hepatology . Nature Clinical Practice Journals . Nature Clinical Practice Nephrology . Nature Clinical Practice Neurology . Nature Clinical Practice Oncology . Nature Clinical Practice Rheumatology . ... New Blackfriars . ...
Data are provided with the intent that they are readily available for personal and public non-commercial use and may be reproduced, in part or in whole and by any means, without charge or further permission from IWSG. However, proper reference to contributors of original data to the database must be provided in all cases, and due diligence should be exercised in ensuring the accuracy of the materials reproduced . ... Bird species report. In : ARCTIC BIRDS breeding conditions survey . ...
Brain Research Group >> Research >> Change-point analysis ... << previous next >> . ... It is necessary to note that a change-point detection method which we applied to a real EEG signal was developed on the basis of the piecewise stationarity model of the signal. ... The data presented in this Chapter demonstrate that the effective detection of the change-points opens the way for a number of new methods of the analysis of complex signals such as the EEG. ...
... Second-year students classes . ... The course offers profound description of popular techniques of parallel programming such as OpenMP and MPI. ... Rapid growth of productivity of the modern computing systems is achieved by using parallel processors and multicore systems. ... As a result, by the and this course, students acquire knowledge about the popular parallel programming techniques, knowledge of modern high-performance computing systems and practical skills to work with them. ... Moscow: Binom...
... To acquaint the reader with nonlinear dynamic systems; . ... The geology investigates of the Earth as a dynamic system. ... The analysis of behavior of systems with nonlinear interplay during time is a subject of this E-textbook. ... Key words: geological processes, dynamic system, nonlinear processes, chaotic dynamics, deterministic chaos, fractals. ... Chapter 1. ... For more information concerning the E-textbook "Dynamic processes in geology: Introduction to nonlinear systems" refer to the...