. Moscow State University . Physics Department . Russian Academy of Sciences . Institute of Organoelement Compounds . Language: . RUS / ENG . Source: russia.ru, 09.2008 . Source: russia.ru, 09.2008 . The news are available in Russian only . Seminar of the Polymer Council of RAS . Seminar in Polymer Physics . Seminar in Electrochemistry

Еще в разделе: (Показать все результаты (>149) - polly.phys.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>30) - lav01.sinp.msu.ru/ )

... Описание вакансии: . The Famous FMCG Company (Top-3) looks for Standards Office Manager in R Department . ... Create and register R and Regulatory documentation . ... Manage update of documentation in valid forms. Daily tracking of documentation validity and make changes in proper time to ensure the correct and on time activity of commercial production. ... Fluent English and excellent computer skills, skills to work with the databases . High skills to work with people; teamwork skills . ...

Еще в разделе: (Показать все результаты (>28) - www.chemport.ru/ )

• "R@d manager" - вакансия в разделе "Работа для химиков" @ChemPort.Ru
• "Head of chemistry" - вакансия в разделе "Работа для химиков" @ChemPort.Ru

Главная Программы Магистратура Программа "Международный бизнес и стратегия" Курсы по выбору МА13 Весна 2013 . International Marketing (Abdolreza Eshghi) . ... Global marketing\'s main job is to create customer value in the global marketplace. This intensive seminar focuses on how managers evaluate global market opportunities and develop market entry and expansion strategies in order to create customer value on a global basis. ... Business Ethics (Gerald Rohan) . ...

Еще в разделе: (Показать все результаты (>4440) - www.mgubs.ru/ )

• Преподаватель ВШБ МГУ Вячеслав Болтрукевич выступил на конференции EFMD
• The Ljubljana Summer school
• Результаты вступительного экзамена в Школу юного менеджера HTML Online Editor

Title Author Key words Review of the monograph Yu.G. Volkova "Creativity: creativity against imitation" Dmitriev A.V. creative class, creativity, creative, imitation This article is reviewed monograph Yu.G. Volkova "Creativity: creativity against imitation" (2013). ...

Еще в разделе: (Показать все результаты (>31) - www.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2011/2/05.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/2/11.pdf
• http://www.socio.msu.ru/vestnik/eng/archive/2014/4/17.pdf

Alexey N. Romanov, Zukhra T. Fattakhova, Denis M. Zhigunov, Vladimir N. Korchak, Vladimir B. Sulimov. On the origin of near-IR luminescence in Bi-doped materials (I). Generation of low-valence bismuth species by Bi3+ and Bi0 synproportionation // Opt. Mater. 2010, doi:10.1016/j.optmat.2010.11.019 . Creation of bismuth-containing near-infrared (NIR) luminescent centers by synproportionation reaction of Bi3+ and Bi0 was demonstrated in borate and phosphate glasses. ...

Еще в разделе: (Показать все результаты (>55) - srcc.msu.ru/ )

• A.Romanov, Z.Fattakhova, D.Zhigunov, V.Korchak, V.Sulimov // On the origin of
• Университетское образование в мире.Чехия
• Laboratory of Informatics

... OLYMPIAD of NSC. This letter contains information about scientific contest - Olympiad, which is held yearly in Chernogolovka: a small pictures- que village not far from Moscow, in which the Noginsk Scientific Center (NSC) of the Russian Academy of sciences is situated. The contest is participated by pupils of the 8-th to the 11-th forms and consists in solving problems in physics, astronomy and mathema- tics. The Olympiad is one of interesting traditions of our scienti- fic centre. ...

Еще в разделе: (Показать все результаты (>8) - www.issp.ac.ru/ )

• Chernogolovka
• Institutes of Chernogolovka

... Главная Факультет политологии Новости факультета Новость . ... На заседании Ученого совета факультета политологии МГУ состоялось торжественное вручение сертификата призеру международного конкурса эссе на английском языке ?Creating the Future We Want?. Декан факультета политологии профессор А. Ю. Шутов поздравил студента III курса Павла Воробьева и вручил ему от имени организаторов конкурса сертификат за глубокое понимание и раскрытие темы. ... Поступление на факультет политологии в 2016 году . ...

Еще в разделе: (Показать все результаты (>9) - polit.msu.ru/ )

• Новости факультета

... ECOLOGICAL COOPERATION" . ... Brjanskaja oblast, Dubrovskij rajon, Seshcha (village), School . Brjanskaja oblast, Djat'kovskij rajon, Bytosh (village), School . ... Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Borodino (village), School . Ivanovskaja oblast, Gavrilovo-Posadskij rajon, Yardenikha (village), School . ... Moscow, Children's Ecological Center of the National Park "Losinyj Ostrov" - the coordinator of ecological work of 18 Korolev-town's schools . Moscow, School #222 . ...

Еще в разделе: (Показать все результаты (>6) - www.ecocoop.ru/ )

Particle pair production in strong EM field, Imaginary temperature and field emission Boris Levchenko SINP MSU, Moscow Tunneling processes (Nature, adv. technologies) Electron field emission from metals: quantum theory by Fowler and Nordheim Results by Sauter and Schwinger for electric field in vacuum Condensed matter .vs. ... QFTHEP'10, BB Levchenko Pair production 16 Scheme of probing strong-field QED in the collisions of a 50-GeV electron beam with a focused laser beam. ...

Еще в разделе: (Показать все результаты (>119) - qfthep.sinp.msu.ru/ )

• http://qfthep.sinp.msu.ru/talks2011/anomalous_wtb_qfthep11.pdf
• http://qfthep.sinp.msu.ru/talks2013/POZDEEVAQFTHEP13.pdf

... Living systems depository "Noah's Ark" . ... About the project . ... The project of the Moscow State University "Noah's Ark" is dedicated to the creation of multi-functional network storage of biological material. ... Creation of temporary prototypes of living systems depository bank for storage and research of the collected material. ... Development of algorithms for the information processes analysis in living systems for receiving, filing and processing of various types of biological data. ...

Еще в разделе: (Показать все результаты (>7) - depository.msu.ru/ )

• Biological information | depozitariy
• Main grant | depozitariy

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>21) - lcl.srcc.msu.ru/ )

LOCAL TSUNAMI WARNING AND MITIGATION ________________________________________________________________________________________________________________________________________ THE NEW GRIDDED KURIL-KAMCHATKA BATHYMETRY FOR TSUNAMI MODELING An. ... For calculations in each grid point where the depth is to be found the algorithm uses up to 9 points from data source. ... Then the spline interpolation is used for defining the depth value in the grid-point. ... Hydrographic Survey Data, CD-ROM data set, Ver. ...

Еще в разделе: (Показать все результаты (>19) - seac47-2.phys.msu.ru/ )

• http://seac47-2.phys.msu.ru/proc/E09_Karlik.pdf

The 3 rd Autumn forum of volunteers in MGU. Last weekend the chemical faculty of MGU held the Autumn forum of volunteers from Russian organization "World4U". The university students and visitors from abroad discussed actual problems of science and life. ... Lectures after V. Vinogradov to be read at the philological department. ... Students of historical department of the Moscow State University are thinking over the possibility to create a Museum of substitutes for modern money. ...

Еще в разделе: (Показать все результаты (>3) - www.rlcentre.com/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>14) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

Lomonosov Moscow State University . ... Academic Programs . ... Academic Departments Programs . ... Russian Language Program . ... There is a well-known fact that if one doesn't know any foreign languages, he has no notion about his mother tongue. ... Moreover, the academic content is connected with the creation of texts in the Russian language relevant to a plan of a speaker and a writer. ... Address: MSU, Faculty of Foreign Languages and Area Studies, Russia, 119192, Moscow, 31/1, rooms 234-235 . ...

Еще в разделе: (Показать все результаты (>115) - ffl.msu.ru/ )

• Научная жизнь

... Shipping Icons . E-Commerce Icons . Building Icons . Hosting Icons . ... But to make your website or interface design a real eye-catcher there was one thing missing: Icons! Icons are an essential tool to simplify user interfaces and today almost every major website uses icons to highlight important parts in their content. ... Visit Website . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>7) - physcontrol.phys.msu.ru/ )

• List All Categories
• Widgetkit

Magnetism Department MSU . ... Magnetism department . ... Magnetic Laboratory was created in Moscow State University by professor Vladimir Arkad ev. ... In 1918 Arkad ev returned in MSU where he founded Moscow Magnetic Laboratory, which exists for a long time on the enthusiasm of their members. ... As the head of new department professor Nikolay Akulov was assigned. ... During the period since 1954 till 1987 the head of magnetism division was Eugeny Kondorsky. ... Lomonosov MSU . ...

Еще в разделе: (Показать все результаты (>9) - magn.phys.msu.ru/ )