... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>24) - mouse.genebee.msu.ru/ )

Events About Structure . At the X Congress of the Russian Union of Rectors the President of RUR V.A. Sadovnichy suggested the creation of interactive inter-university scientific and educational project "University Department" . ... In 2015, as part of the National Strategy of actions in interests of children the Interdisciplinary Research and Education Center for Childhood Fundamental Studies was created in the Human Research Institute of Moscow State University . ...

Еще в разделе: (Показать все результаты (>43) - www.rsr-online.ru/ )

• RSR online

... IMPACT: New carbon-based materials with exceptional chemical and physical properties . ... AREA: Condensed Matter Physics, Physical Chemistry, Structure and Dynamics of Atomic-Molecular Systems, Engineering Sciences and Mechanical Engineering . ... Moscow State Uiversity . ... STRATEGY: Application of ab initio methods for simulation of forbidden reflections energy spectra taking into account thermal displacements of atoms and protons fluctuations. ... AREA: Condensed Matter Physics . ...

Еще в разделе: (Показать все результаты (>56) - hpc.msu.ru/ )

• APPLICATIONS: Optics and Quantum Electronics | Moscow University Supercomputing
• Supercomputing Education Project | Moscow University Supercomputing Center
• SIGMA: Collective Bank of Tests on Parallel Computing | Moscow University

... The given course consisting of lectures and seminars is aimed at teaching our students a whole range of measures, which allow quick and efficient faultfinding, functional testing, reliability testing of a device, find replacement for a faulty component at the modern technological level, fix a device, create a similar device even without the blueprints. ... Programming an unknown board on TestVue Software . ... Functional testing of an unknown board; comparison with the pattern . ...

Еще в разделе: (Показать все результаты (>69) - engineering.phys.msu.ru/ )

• Jumping Robot

... I would like to invite you to visit my website http://www.againstchance.webs.com/ where I present the demonstration of my invention, the device for predicting the Future. It is a computer program which reveals the reaction of the computer to the future creation of a file, and since the command to create a file can be given to the computer in accordance with the outcome of any external event, such a reaction can predict that event, too. ...

Еще в разделе: (Показать все результаты (>19) - temporology.bio.msu.ru/ )

... О лаборатории . ... Состав лаборатории . ... Create new account (active tab) . ... E-mail address * . A valid e-mail address. All e-mails from the system will be sent to this address. The e-mail address is not made public and will only be used if you wish to receive a new password or wish to receive certain news or notifications by e-mail. Group - None - 217 (2016 год) 219 (2016 год) 217 (2015 год) 215 (2015 год) 217 (2014 год) 215 (2014 год) 315 316 219 218 117 CAPTCHA . ...

Еще в разделе: (Показать все результаты (>209) - nanolab.phys.msu.ru/ )

• User account | Laboratory of Nanophotonics & Metamaterials
• Our paper has been published in Scientific Reports | Laboratory of
• Vasyakov Alexey Alexandrovich | Laboratory of Nanophotonics & Metamaterials

... Institutes of Chernogolovka . The largest of all the scientific institutions of the center is the Institute of Chemical Physics in Chernogolovka , where fundamental problems of chemical physics are studied: kinetics and mechanisms of chemical and biological processes; processes of combustion, explosion, and polymerization; and mechanisms of elementary reactions involving high energy particles. ... Developments and Technologies . ...

Еще в разделе: (Показать все результаты (>21) - www.issp.ac.ru/ )

• Olympiad of Scientific Centres
• Chernogolovka

... Working channel dimensions: length - 1200 mm, width - 300 mm, height - 30 mm; 50mm. Air velocity range in a working channel: 5-120 m/s with a step 0,1 m/s. Mass air rate: 0,2-1,3 kg/s . ... Model/flow temperature difference: up to 120C . ... Aerodynamic unit 'SAU-Siemens' was created to investigate heat exchange intensification on the surfaces with complex relief (dimples, grooves, etc) in flat channels at subsonic flow of working medium (air). ...

Еще в разделе: (Показать все результаты (>10) - termogaz.imec.msu.ru/ )

• aboutLab

... A new image object format suggested. ... DataPtr ­ pointer to image data row. ... Collections.Generic; System.Windows.Forms; Microsoft.JScript; Microsoft.JScript.Vsa; Microsoft.Vsa; } return result; // Reading script from file public static string ReadScriptFromFile( string fileName) { System.IO.StreamReader sr = new System.IO.StreamReader(fileName); string sScript = ; try { sScript = sr.ReadToEnd(); } catch (Exception ex) { //TODO } finally { sr.Close(); } } return sScript ...

Еще в разделе: (Показать все результаты (>132) - imaging.cmc.msu.ru/ )

• Basic edges | Laboratory of Mathematical Methods of Image Processing
• View publication | Laboratory of Mathematical Methods of Image Processing

... Geography of World Economy . ... Recreational Geography and International Tourism . ... Departments . ... Field training . ... The department curriculum is focused on preparation of experts of the top skills in the field of tourist business, tourist service, the government in tourism sphere. ... A theme of scientific work of department Territorial touristic-recreational systems: natural and social and economic preconditions of a sustainable development includes three underthemes. ...

Еще в разделе: (Показать все результаты (>46) - eng.geogr.msu.ru/ )

• Department of Land Hydrology

... Graduate student, School of Public Administration, Lomonosov Moscow State University. ... The purpose of this article is to analyze the creation of the Bryansk search station in 1909 in the context of political police reform in the Russian Empire. The author considers special conditions of political police activity in Bryansk district, explores the reasons for creating a search station, evaluates the role of Central Regional Secret Political Police Department. ... Public Administrarion". ...

Еще в разделе: (Показать все результаты (>526) - ee-journal.spa.msu.ru/ )

... Research . ... Linguistic expeditions . ... Up to now the subjects to documentation were local dialects of Selkup, Ket, and Evenki. ... 1) creation and enlargement of multimedia computer archives of Selkup, Ket, and Evenki speech, which include sounding dictionaries and folklore texts and life-stories in audio, video, and graphic representation in local dialects of the surveyed villages; development of linguistic multimedia databases; . ... 8) research into the Selkup-Ket-Evenki language contacts; ....

Еще в разделе: (Показать все результаты (>22) - lcl.srcc.msu.ru/ )

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>7) - psyberlink.flogiston.ru/ )

... As a perfect bag of Hermes, it isn?t strange to determine it sold at $6,750. ... Didn`t suggest we don?t adore determine producer creative designers, . ... We will try our excellent to dig his worth come up with him merged properly making use of the brand, . ... I stated to plenty of folks that Christophe may be among the many most ideal one, . ... Leather: Handbags created by Hermes uses only animal skin. ... http://www.slcamera.it/every-man-adores-his-car/ . ...

Еще в разделе: (Показать все результаты (>96) - elana.sinp.msu.ru/ )

• cheap moncler uk Adaptive Shirts for Decreased Shoulder Range of Motion | С
• absurdly. | С Днем Победы!
• ralph lauren outlet uk Health Benefits of Soft Water | С Днем Победы!

... Scientific Effort . ... Cosmic ray astrophysics . Space Physics . ... Nuclear physics . ... The paper was prepared with contributions from Elena Popova from the Skobeltsyn Institute of Nuclear Physics (Lomonosov Moscow State University) and was published in Scientific Reports. ... Federal State Budget Educational Institution of Higher Education M.V.Lomonosov Moscow State University, Skobeltsyn Institute of Nuclear Physics (SINP MSU), 1(2), Leninskie gory, GSP-1, Moscow 119991, Russian Federation . ...

Еще в разделе: (Показать все результаты (>5) - sinp.msu.ru/ )

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>35) - ideas.msu.ru/ )

• http://ideas.msu.ru/docs/EPSS_guide.pdf

Клуб выпускников МГУ (Московский Государственный Университет) . By national TV "NEW CHANNEL", UKRAINE. New quantum technology in the field of biocybernetics . ... NEW CYBERNETIC BODY WITH THE BEST QUALITY OF REAL LIFE. ... B контексте моей теории плазма, это не ионизированный газ, а форма материи, из которой состоит внутренняя структура частиц. ... NEW QUANTUM THEORY OF ATOM'S NUCLEUS PRESENTED BY THE AUTHOR, DR. KOSTIANTYN RASIN. ... NEW ERA OF QUANTUM TECHNOLOGIES JUST BEGUN.. ...

Еще в разделе: (Показать все результаты (>483) - www.moscowuniversityclub.ru/ )

Sign in Register . ... Resources . ... Forums . ... 495) 3334-65-56 . info@ecfs.msu.ru . All contacts . ... Home Forum . ... Search in section Everywhere Основная дискуссия -Ongoing consultations/ Текущие онлайн конференции -Прошедшие онлайн конференции -Общая дискуссия -Евразийское почвенное партнерство . ... Основная дискуссия . Ongoing consultations/ Текущие онлайн конференции . ... Прошедшие онлайн конференции . ... Общая дискуссия . ... The Department of land resources . ... Forum . ...

Еще в разделе: (Показать все результаты (>25) - ecfs.msu.ru/ )

• Ongoing consultations/ Текущие онлайн конференции | ECFS
• About Eurasian Center for Food Security | ECFS

... THE LJUBLJANA SUMMER SCHOOL 2006 . ... THE LJUBLJANA SUMMER SCHOOL 2006 is a new intensive programme open to both undergraduate and graduate students of Business, Economics, and other fields of Social Sciences. The programme was created at the Faculty of Economics in Ljubljana in order to impart knowledge by taking full advantage of our country s unique geographical position: the meeting point of East and West. ... The Summer School s aim is to learn by applying knowledge to real-life situations. ...

Еще в разделе: (Показать все результаты (>1459) - www.mgubs.ru/ )

• Высшая школа бизнеса МГУ им. Ломоносова
• В газете The Northeastern Voice (Northeastern University) вышла статья про
• Преподаватель ВШБ МГУ Вячеслав Болтрукевич выступил на конференции EFMD

. Veronika K. Laurinavichyute . /Lunina/ . Senior Scientific Researcher, PhD . CV . Selected Publications . News: . 12.08.2013. - Page updated 20.07.2013. - Project GRAVITSAPA started 01.07.2013. - Published: Practical exercises in physical chemistry. MGPU. Part 2. 2013 16-21.06.2013. - Workshop on composite materials, Harbin 10.04.2013. - On-line publication: Electrochimica Acta (2013), pp. 102-107 23.03.2012. - Website created! . nika@elch.chem.msu.ru . +7(495)939-1321 . Back

Еще в разделе: (Показать все результаты (>99) - electr003.chem.msu.ru/ )