... This work is aimed at Monte-Carlo analyzing the energy-angle distributions of fast protons reflected from a steel surface and at comparing theory and experiment [1,2]. cade initiated by ion bombardment [10,11] and in the collisions of ions with foil [12]. ... The projectile ion energy decreases in each collision. ... The parameter Emax ?hо that characterizes the energy at which the reflected proton energy distribution in collisions with the steel surface at a small angle a М 4А is peaking. ...

Еще в разделе: (Показать все результаты (>119) - danp.sinp.msu.ru/ )

• http://danp.sinp.msu.ru/LAS/Nimb230_05_583ShulgaMashkova.pdf
• http://danp.sinp.msu.ru/LIIWM/PhysRevA64_2001_023201NMKab.pdf
• http://danp.sinp.msu.ru/Tulinov_85/NIMB267(2009)2592-AFT.pdf

D.Sokoloff, Long-term dynamics of solar cycle, geomagnetic reversals and fluctuations of dynamo governing parameters, European Geoscience Union, General Assembly, Vienna, 2012, EGU2012-1514, p.1514). As a matter of fact, cyclic behavior of solar activity demonstrates a dynamics on the timescales which are much longer then the cycle period. ... A model which relate such phenomena with random variations of alpha-effect (or other governing mean-field dynamo parameters) is suggested. ...

Еще в разделе: (Показать все результаты (>206) - srcc.msu.ru/ )

• Sokoloff D., Zhang H., Moss D., Kleeorin N., Kuzanyan K., Rogachevski I., Gao
• Conferences
• D.Moss, R.Stepanov, T.G.Arshakian, R. Beck, M.Krause, D.Sokoloff, Multiscale

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>13) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search

PAL2NAL output ERROR: if "codon(Output format)" is selected, don't use "Remove gaps, inframe stop codons" or "Remove mismatches" or "Use only selected positions". Synonymous (KS) and non-synonymous (KA) substitution rates calcualted by codeml in the PAML package: KS = 2.2360 KA = 0.2265 KA/KS = 0.1013 You can see the parameters used in codeml to calculate these values. If you use these values, please cite the following peper: Goldman, N. and Yang, Z. 1994. ...

Еще в разделе: (Показать все результаты (>8878) - kodomo.fbb.msu.ru/ )

• allpy: 1785e40b2a2d allpy/fileio.py
• allpy: log
• allpy: 1785e40b2a2d allpy/dna.py

DESCRIPTION OF THE TIME PROFILES OF KEY GEOMAGNETIC AND SOLAR WIND PARAMETERS . Time profiles of key geomagnetic parameters ( Ap and Dst indices) are shown together with key parameters of the solar wind (velocity V , density n and temperature T ) and IMF ( B , Bx , By , Bz in GSM coordinate system). ... High time resolution data on the solar wind plasma is obtained from Wind experiment in 1997 and ACE experiment in 1998-2002 using ISTP data base . ...

Еще в разделе: (Показать все результаты (>13) - dbserv.sinp.msu.ru/ )

• Catalogue of Space Storms

... Structure of Data . ... Catalog . ... In SAI OCL Catalog, we introduce our work on investigation of the Milky Way system of open star clusters. The main goal of our study is a search for new clusters using huge surveys. 168 new clusters have been already discovered by us using J,H,Ks data from 2MASS point source catalog. ... For 141 new clusters, we found their physical parameters using J,H,Ks data from 2MASS catalog and, for a number of clusters, our UBVRI CCD observational magnitudes. ...

Еще в разделе: (Показать все результаты (>5) - ocl.sai.msu.ru/ )

• SAI OCL Catalog Structure

... News . ... TLE news . ... Publications on Transient luminous events . ... The UHECRs will be detected through the measurement of the emission in the range between 290 and 430 nm, where some part of Transient Luminous Events (TLEs) emission also appears. ... Luminous event parameters (atmosphere altitude, energy released to radiation, and temporal pro?les) are similar to observed elsewhere parameters of transient luminous events (TLE) of elves, sprites, halo, and gigantic blue jets types. ...

Еще в разделе: (Показать все результаты (>25) - uhecr.sinp.msu.ru/ )

• UHECR news
• Новости КЛПВЭ
• Global transients in ultraviolet and red-infrared ranges from data of

... Fluorescence induction curves registered from individual microalgae cenobiums in the process of population growth. ... Registration of chlorophyll fluorescence induction curves (IC) from individual microalgae cenobiums was performed during Scenedesmus quadricauda culture growth. ... Recording of the fluorescence induction curve for each individual cenobium was performed during 200 s. In the process of algae cultivation (52 days) 846 fluorescence kinetic curves were recorded. ...

Еще в разделе: (Показать все результаты (>43) - www.library.biophys.msu.ru/ )

• МОДЕЛИРОВАНИЕ ВЗАИМОДЕЙСТВИЯ МАГНИТНОГО ПОЛЯ С ОБЪЕМНЫМИ ВЯЗАНЫМИ СТРУКТУРАМИ

О лаборатории . ... Лаборатория теоретической биофизики . ... Here the guide to use RESP technique based on calculations from Firefly or GAMESS-US is presented. ... Note, that RESP algorythm will fit potential in the set of points which are selected according to $PDC group in the input-file. ... Нет комментариев " Using RESP with GAMESS-US and Firefly (PC-GAMESS) " . ... Using Firefly/GAMESS-US efficiently . ... Scannin? in Using Firefly/GAMESS-US efficiently? 2012 ERG Research Group . ...

Еще в разделе: (Показать все результаты (>40) - erg.biophys.msu.ru/ )

• gromacs ERG Research Group: Лаборатория теоретической биофизики
• All-atom automatic OPLS-AA topology generator ERG Research Group: Лаборатория
• Quantum chemistry information page ERG Research Group: Лаборатория

The purpose of the space-physics lab exercises is to introduce the students to the methods of the measurements, to the modern conception of near-Earth space structure and the physical processes and phenomena occured in it. ... At present the reasearches and the teachers of the University and of other institutes participating in the project continue development of the the special space-physics lab exercises, and they are interested in your ideas concerning the future exercises. ...

Еще в разделе: (Показать все результаты (>58) - cosmos.msu.ru/ )

Subdeletion structures as additional evidence for different analysis of synthetic and analytic comparatives in Russian In Russian there are two seemingly interchangeable comparative forms of adjectives: synthetic (the suffix -ee) and analytic (the word bolee). ... One more peculiar characteristic pertaining to synthetic rather than analytic comparatives in Russian is the inability of the former to appear in so-called subdeletion structures. ... Masa vyse Vani. i(analytic+GEN). ... Pancheva, Roumyana. ...

Еще в разделе: (Показать все результаты (>311) - www.philol.msu.ru/ )

• http://www.philol.msu.ru/~otipl/SpeechGroup/publications/krivnova-2001-2004/krivnova_bogdanov_specom-2004.doc
• http://www.philol.msu.ru/~otipl/new/main/courses/modelling/vocal%20tract%20extraction%202009.pdf
• http://www.philol.msu.ru/~rkigf/P_Objavlenija/Konferencii/Konferencii_2011/2011_09_Grec_form2011.pdf

... C12H17NO DOI: 10.1107/S1600536804009651 organic papers Data collection Bruker SMART 1000 CCD areadetector diffractometer 9 and 3 scans Absorption correction: multi-scan (SADABS; Sheldrick, 1998 ) Tmin = 0.991, Tmax = 0.992 7211 measured reЇ ections 2498 independent reЇ ections 1435 reЇ ections with I 2' (I) Rint = 0.007 max = 28.0 h = 10 3 11 k = 19 3 19 l = 9 3 11 H-atom parameters constrained w = 1/[' 2(Fo2) + (0 ... Albov, D. V., Rybakov, V. B., Babaev, E. V. & Aslanov, L. A. (2004). ...

Еще в разделе: (Показать все результаты (>154) - www.chem.msu.ru/ )

• Program ODF3
• THE EFFECT OF CATALYST ON INTERMOLECULAR HETEROGENEITY DISTRIBUTION IN

... Paradigm shifts by Kuhn: successive change of one model by another, rather than integration of different paradigms Progress of science: from single- to multi-model approach Some examples from natural science... · theory of light: from vibration of ether to wave-particle duality · laws of motion: from Newton's dynamics to SchrЖdinger 's and Heisenberg's formalism In social and environmental sciences appreciation of the multi-model ...

Еще в разделе: (Показать все результаты (>12) - oc.cs.msu.ru/ )

... solvation nucleation of the polymorphs Solute-solute interactions, association parameters , thermodynamics parameters , conformations growth of the crystal Nature of solvent, intermolecular interactions (solute ­ solvent, solute-solute), conformations Lattice energy , entropy of the crystal, symmetry of the lattice, conformations The conformational manifolds is the candidate to be a coordinate of reaction Methods of investigations Quantum chemistry ...

Еще в разделе: (Показать все результаты (>15) - www.elch.chem.msu.ru/ )

• http://www.elch.chem.msu.ru/mole/lecture/basilevsky.pdf
• http://www.elch.chem.msu.ru/mole/lecture/probst.pdf

EVOLUTION OF GALACTIC DISCS: TWO MODES OF STAR FORMATION ABSTRACT We develop the model of the evolution of surface gas density, stellar density, star formation rates and chemical composition of galactic disc taking into account the gravitational instability of rotating gaseous layer in the scales of several kpc. ... In the model we took into account the gas return from evolved stars, a radial movement of the gas in a spiral arms and accretion of the gas into the galactic disc. ...

Еще в разделе: (Показать все результаты (>91) - comet.sai.msu.ru/ )

• Interdisciplinatory Colloquium on cosmic factors of evolution of the biosphere
• Understanding HTML and MIME
• Creating a distribution list

... О UNИX . ... LibraryGnomeOrg_Evolution . Неизменяемая страница . ... Прикрепленные файлы . Другие действия: Показать разметку Вид для печати Сформатировать как Docbook Очистить кэш страницы ------------------------ Проверить правописание Похожие страницы Карта окрестностей ------------------------ Переименовать страницу Удалить страницу ------------------------ Подписать пользователя ------------------------ Очистить от спама Вернуть эту версию Страницы пакета Синхронизировать ...

Еще в разделе: (Показать все результаты (>151) - uneex.mithril.cs.msu.su/ )

• HelpOnMoinCommand/ExportDump - UNИX
• Index of /static/LibraryGnomeOrg_Evolution
• Index of /static/LibraryGnomeOrg_Evolution/figures

... VaST is a software tool for finding variable objects on a series of astronomical images. ... VaST performs object detection and aperture photometry using SExtractor on each image, cross-matches lists of detected stars, performs magnitude calibration with respect to the first (reference) image and constructs a lightcurve for each object. ... VaST FITS image viewer ./pgfv . ... Part I" PZP, vol. ... K. V. Sokolovsky, S. A. Korotkiy; "New Variable Stars Discovered by the NMW Survey" PZP, vol. ...

98. SystemRequirements < System < Foswiki

99. Пятый чемпионат ГЗ по Pro Evolution Soccer - Public forum of MSU united student

100. http://genphys.phys.msu.su/rus/sci/optics/literature/15.pdf