... It has been shown [1], that in some cases, in chaos set A the sub-set B can exist, in which the chaos behavior can be stabilized by external parametrical perturbations. ... As the first step I've found the A set (the set of chaotic behavior) and as a second step, by using different parameters combination (that can be consider as parameter perturbations of the system) I've found the B set (the set, where some stable cycles exists). ... For the f(x)=ax(1-x) map this is [3,8 4,0] interval. ...

Еще в разделе: (Показать все результаты (>71) - chaos.phys.msu.ru/ )

Lomonosov Moscow State University , Skobeltsyn Institute of Nuclear Physics . ... Links . ... CDFE => Links . ... Space Physics Online Data Services at MSU SINP . Japan Atomic Energy Research Institute Nuclear Data Center . Korean Atomic Energy Research Institute Nuclear Data Center . MacNuclide Nuclear Data Base Management System . ... Radiation Safety Information Computational Center , Oak Ridge National Laboratory . ... Los Alamos National Laboratory Nuclear Data Viewer . ...

Еще в разделе: (Показать все результаты (>4925) - cdfe.sinp.msu.ru/ )

• CDFE - Centre for Photonuclear Experiments Data - Home page
• CDFE => Online Services

On-line Data . COHO data . ... PIONEER 10 . ... PIONEER VENUS ORBITER . OMNI data . OMNI Data Set . LASRE data . CORONAS-I (electrons) . CORONAS-I (protons) . ... COSMOS 1686 (electrons) . COSMOS 1686 (protons) . ... Satellite Informations Selector . ... AKEBONO AMPTE Cluster II / Phoenix DMSP Dynamics Explorer (DE) Equator-S FAST Freja GOES-7 GOES-8 Geotail Hawkeye IMAGE (GSFC) IMAGE (SwRI) IMP-8 ISEE Interball LANL MSX Oersted POLAR SAMPEX SOHO UARS Ulysses Voyager WIND . ...

Еще в разделе: (Показать все результаты (>28) - dbserv.sinp.msu.ru/ )

• ULYSSES Online Data Set Selector
• BAFIZ
• BAFIZ at SINP MSU

HOW DOES CRYSTAL CHEMISTRY PREDICT STRUCTURE AND PROPERTIES OF CRYSTALS V. S. URUSOV Crystal chemistry has created a set of methods and procedures to predict structure and properties of crystals. ... З. л. мкмлйЗ еУТНУ,ТНЛИ ,,УТЫ ТЪ,ВММњИ ЫМЛ,В ТЛЪВЪ ЛП. е.З. гУПУМУТУ, ї м ЫТУ, З.л., 1997 . ... мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм.. ... 1 мкмлйЗ З.л. дДд дкалнДггйпаеаь икЦСлдДбхЗДЦн лнкмднмкм а лЗйвлнЗД дкалнДггйЗ 43 . ... Ti4+ 2 -, 1 : 2 , . 2 --2 - Ti4+-Ti4+) , (2 --Ti4+). ...

Еще в разделе: (Показать все результаты (>48) - cryst.geol.msu.ru/ )

• http://cryst.geol.msu.ru/literature/WOS.pdf

... Modeling of Temperature Field in Tissue Created by Therapeutic Phased Arrays with Regular and Random Distribution of Elements . ... Numerical algorithms for modeling of arbitrary three-dimensional acoustic and temperature fields in biological tissue are developed. Spatial distributions of acoustic intensity and temperature patterns in tissues created by two-dimensional therapeutic phased arrays with regular or random distribution of circular elements on a spherical shell are investigated. ...

Еще в разделе: (Показать все результаты (>654) - acs366.phys.msu.su/ )

... About the project . ... Biological information . As part of the project areas we will develop the scientific basis for the creation of infrastructure solutions and knowledge-based platforms for a comprehensive biodiversity study in Russia on the basis of genomic and storage technologies, analysis and exchange of data different types. ... Solution of problems set out in the project area will have the long-term effect in the various fields of science and engineering disciplines in the social sphere. ...

Еще в разделе: (Показать все результаты (>6) - depository.msu.ru/ )

• depozitariy | Living systems depository "Noah's Ark"

... Supercomputing Technologies in Science, Education and Industry Almanac Series . AlgoWiki: an Open Encyclopedia of Parallel Algorithmic Features . ... X-COM: Distributed Computing Software . SIGMA: Collective Bank of Tests on Parallel Computing . ... Every teacher can make up his own set of tests using the collective data bank or using his own questions. ... Universities participating: 20 . ... Tests held: 413 . ... Research Computing Center (RCC) of Lomonosov Moscow State University . ...

Еще в разделе: (Показать все результаты (>70) - hpc.msu.ru/ )

• Supercomputing Education Project | Moscow University Supercomputing Center
• APPLICATIONS: Condensed Matter Physics | Moscow University Supercomputing...
• APPLICATIONS: Plasma Physics | Moscow University Supercomputing Center

... Cultural Mediation of National History and Identity . ... Second International Conference in Tampere , Finland . ... This sense of national identity, of history and possible futures, is communicated by cultural and institutional forces and integrated, individually and collectively, into our sense of a common shared nationhood. ... Through a semiological analysis of television texts, it is demonstrated how, by a re-interpretation of Russian history, new cultural and national identities are...

Еще в разделе: (Показать все результаты (>8) - psyberlink.flogiston.ru/ )

... Departments . ... Knizhnikov Y.F. (aerospace stereo modeling, remote sensing), Doctor of Geography; . ... Advanced research is in the field of further development and integration of geographic cartography theory and methods, geoinformatics and remote sensing; the use of satellite and aircraft monitoring in geography and cartography; creating regional and local GIS; WEB- mapping; satellite positioning systems; the development of geographic information and online technologies, thematical geoportals. ...

Еще в разделе: (Показать все результаты (>109) - eng.geogr.msu.ru/ )

• Recreational Geography and Tourism
• World Data Center for Geography
• Department of Oceanology

e-mail: infoippk@sfedu.ru) , , , , creative class, creative value, consumer practices, creative activities, social selfesteem . The article is devoted to analyzing the influence of the creative class on the consolidation of Russian society. ... This fact determines the impact of creative class on the acceptance of values of social creation by Russian society, as the basic value that has influence on the formation of social development priorities. ...

Еще в разделе: (Показать все результаты (>47) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2013/2/06.pdf
• http://www.socio.msu.ru/vestnik/archive/2014/1/13.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/2/07.pdf

... file . ... file log . ... 2 ftp://ftp.ebi.ac.uk/pub/databases/rcsb/pdb/data/monomers/components.cif.gz . 3 codes_py = allpy/data/codes.py . 4 components_cif = allpy/data/components.cif . ... 6 all: doc codes tests . ... 11 doc: . 12 sphinx-autopackage --suffix = rst --dest-dir = docs/source/allpy/ allpy . 13 $( MAKE ) -C docs html . ... 15 force-doc: . 16 rm docs/source/allpy/* . 17 rm -rf docs/build . ... 20 codes: $( codes_py ) . ... 26 $( codes_py ) : $( components_cif ) . ...

Еще в разделе: (Показать все результаты (>14936) - kodomo.fbb.msu.ru/ )

• allpy: c32e728b98d7 Makefile
• allpy: b332f8026bb8 Makefile
• allpy: cb547d665599 Makefile

... The main field of my investigations is stellar spectrophotometry. As a result of scientific activity of our group spectrophotometric catalog was created including energy distribution data on 900 stars in the range 3200-7600AA and 250 stars in the range 6000-10800AA (Voloshina et al., Spectrophotometry of Bright Stars, ed. I.N.Glushneva, 1982, Moscow, Nauka, in Russian). ...

Еще в разделе: (Показать все результаты (>17) - uranus.sai.msu.ru/ )

• The Database of Close Binary Systems

Host: localhost Database: atomax2 --------------------------------------------------------- -- Server version 3.23.52-nt -- -- Table structure for table ' deliveries ' -- DROP TABLE IF EXISTS deliveries ; CREATE TABLE deliveries ( id_delivery int (11) NOT NULL auto_increment, subj varchar( 255 ) default NULL , author varchar( 255 ) default NULL , type tinyint (4) default ...

Еще в разделе: (Показать все результаты (>7) - textbook.sinp.msu.ru/ )

• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.mysql
• http://textbook.sinp.msu.ru/modules/ax_visitors/visitors.sql

pic] European Commission - Press release E7 billion boost for research and innovation will create jobs and growth Brussels, 19 July 2011 - Today Commissioner MАire Geoghegan-Quinn announced nearly E7 billion to kick-start innovation through research. ... Today, Europe is again showing its commitment to putting research and innovation at the top of the political agenda for growth and jobs. ... Research and innovation for cleaner, safer and more efficient transport and mobility will get E313 million. ...

Еще в разделе: (Показать все результаты (>33) - ideas.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>19) - mouse.genebee.msu.ru/ )

... Faculties . ... General Information . ... Study and Research . ... The Faculty has 18 departments: Department of General Mathematics , Department of Non-Linear Dynamic Systems and Control Processes, Department of Mathematical Physics, Department of Computational Methods, Department of Research Automation, Department of Operations Research , Department of Optimal Control, Department of System Analysis, Department of Mathematical Statistics, ...

Еще в разделе: (Показать все результаты (>115) - www.msu.ru/ )

• Faculty of Soil Science
• Faculty of Materials Science
• MSU Web Sites

. Moscow State University . Physics Department . Russian Academy of Sciences . Institute of Organoelement Compounds . Language: . RUS / ENG . Source: russia.ru, 09.2008 . Source: russia.ru, 09.2008 . The news are available in Russian only . Seminar of the Polymer Council of RAS . Seminar in Polymer Physics . Seminar in Electrochemistry

Еще в разделе: (Показать все результаты (>414) - polly.phys.msu.ru/ )

• State prize - Chair of Polymer and Crystal Physics
• Practicums - Chair of Polymer and Crystal Physics

... Create new account . ... April 11, 2013 - Bashneft Group in conjunction with JSFC "Sistema" opened the programme for the development of key Bashneft Group management - School of CEOs, "Capsule of security". The programme is developed by the Higher School of Management and Innovation - Faculty of the Lomonosov Moscow State University - specifically for the professional development of JSFC "System?s" employees . ... MSU website . ... 2006-2016 MSU Higher School of Management and Innovation. ...

Еще в разделе: (Показать все результаты (>28) - hsmi.msu.ru/ )

• Opening of the educational programme - School of CEOs, "Capsule of security"
• MSU Higher school of management and innovation |
• School overview | MSU Higher school of management and innovation

Backlinks to DataForms in all Webs ( Search System Web only ) . ... Appendix C: CSS Listing of CSS class names emitted from Foswiki core code and standard extensions. ... NEW - 28 Aug 2011 - 11:49 by ProjectContributor . ... NEW - 03 Aug 2010 - 16:42 by ProjectContributor . ... Statistics for System Web Month: Topic views: Topic saves: File uploads: Most popular topic views: Top contributors for topic save and uploads: ... r1088 - 22 Nov 2013 - 23:01 by AdminUser . Number of topics: 29 . ...

Еще в разделе: (Показать все результаты (>18657) - wiki.cs.msu.ru/ )

• (backlinks in System Web) DataForms < System < Foswiki
• (backlinks in all Webs) MainFeatures < System < Foswiki
• (backlinks in System Web) MainFeatures < System < Foswiki

... ZOO is a flexible and powerful content application builder to manage your content. ... ZOO moves from simply being a CCK to an Application Builder. Apps are extensions for ZOO which are optimized for different purposes and types of content catalogs. ... A flexible and powerful content application builder to manage your content. Download ZOO . ... escort beylikduzu bayan escort escort bayan escort escort istanbul escort bayan porno film escort istanbul escort beylikduzu escort bayan ...

Еще в разделе: (Показать все результаты (>9) - physcontrol.phys.msu.ru/ )

• List All Categories
• Icons