... ÝÎÑ èñòôàêà ÌÃÓ . ... x25BA; Êàôåäðà èñòîðè÷åñêîé èíôîðìàòèêè . ... Course categories: Êàôåäðà èñòîðèè ñðåäíèõ âåêîâ Êàôåäðà èñòîðè÷åñêîé èíôîðìàòèêè Êàôåäðà èñòîðè÷åñêîé èíôîðìàòèêè / Ïðàêòèêà èñïîëüçîâàíèÿ ÄÎÒ Êàôåäðà èñòîðèè Ðîññèè äî íà÷àëà XIX âåêà Êàôåäðà íîâîé è íîâåéøåé èñòîðèè ñòðàí Åâðîïû è Àìåðèêè Êàôåäðû ýòíîëîãèè Àðõåîãðàôè÷åñêàÿ ëàáîðàòîðèÿ Øêîëà ó÷èòåëåé èñòîðèè . ... Èíôîðìàöèîííûå òåõíîëîãèè è ìàòåìàòè÷åñêèå ìåòîäû â èñòîðè÷åñêèõ èññëåäîâàíèÿõ è îáðàçîâàíèè . ... Home ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>4336) - www.hist.msu.ru/ )

• ÝÎÑ èñòôàêà ÌÃÓ: Course categories
• Ýëåêòðîííàÿ îáðàçîâàòåëüíàÿ ñðåäà èñòîðè÷åñêîãî ôàêóëüòåòà ÌÃÓ èìåíè
• Summary of Èñòîðèÿ Äðåâíåãî Ìèðà

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - www.kids.genebee.msu.ru/ )

... x25BA; Login to the site . Skip to create new account . Login here using your username and password . ... Username . Password . ... Some courses may allow guest access . ... For full access to courses you'll need to take a minute to create a new account for yourself on this web site. ... You can now access the full course. From now on you will only need to enter your personal username and password (in the form on this page) to log in and access any course you have enrolled in. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>2) - moodle.ffl.msu.ru/ )

... SHORT COMMUNICATIONS HCh: New Potentialities for the Thermodynamic Simulation of Geochemical Systems Offered by Windows Yu. ... Both of these possibilities have already been implemented in the HCh package [1] but 834 HCH: NEW POTENTIALITIES FOR THE THERMODYNAMIC SIMULATION User User's programs 835 Unitherm program Main program Gibbs program Thermodynamic database Working files of the project External modules of the user Fig. ... The third entry point at the user's module is the main ("working"). ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>34) - www.geol.msu.ru/ )

• Software for resistivity and induced polarization

e-mail: vid@socio.msu.ru) , , .. , national sociology, Russian national sociology, P.A. Sorokin. In contrast to Yadov V.A., the author claims the necessity and the inevitability of the development of national original Russian sociology. Dobrenkov applies to the works of famous Russian sociologists (Sorokin P.A., Bulgakov S.N., Knipovich B.N., Kosinskiy V.A.) whose ideas have influenced greatly on Russian and world sociological tradition. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>6) - vestnik.socio.msu.ru/ )

• http://www.socio.msu.ru/vestnik/archive/2010/4/11.pdf
• http://www.socio.msu.ru/vestnik/archive/2010/4/14.pdf
• http://www.socio.msu.ru/vestnik/archive/2012/1/09.pdf

Open Conference Systems . Conference Help . ... Conference Content Search . All Authors Title Abstract Index terms Full Text . ... For Readers . ... Home . ... Search . Current Conferences . Home > ICONO/LAT 2016 > About the Conference > Conference Policies . Archive Access Policy . The presentations that make up the current and archived conferences on this site have been made open access and are freely available for viewing, for the benefit of authors and interested readers. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>25) - hea.phys.msu.su/ )

• About the Conference

... http://www.mmonline.ru/message/4509/ . ... Ìàòåìàòè÷åñêèé ñåìèíàð Ãëîáóñ 17 èþíÿ . 27 èþíÿ 2004 ãîäà (÷åòâåðã) â 15:40 â êîíôåðåíö-çàëå ÍÌÓ, Á. Âëàñüåâñêèé, 11 ñîñòîèòñÿ î÷åðåäíàÿ ëåêöèÿ ñåìèíàðà Ãëîáóñ An introduction to cluster algebras . ... After introducing cluster algebras, I will discuss their main structural properties including the finite type classification which turns out to be completely parallel to the famous Cartan-Killing classification. ... http://www.mmonline.ru/ . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>85) - www.mmonline.ru/ )

• MMOnline | Ôîðóìû | Ðàçíîå | Êàê ïîëó÷èòü University Sealed Envelope â ÌÃÓ?
• Äî 1 íîÿáðÿ Springer ïðåäîñòàâëÿåò áåñïëàòíûé äîñòóï ê áîëåå ÷åì 150
• Ñòèïåíäèÿ LSI Logic äëÿ àñïèðàíòîâ ÌÃÓ

... Loskutov, and E. V. Ryadchenko Presented by Academician A.R. Khokhlov April 22, 2005 Received April 26, 2005 The problem of the identification and biological significance of chromosome fragments and complete genomes is approached on the basis of the representation of a sequence of DNA nucleotides as a two-dimensional walk. ... However, as applied to DNA, functional and structural fragments of a chromosome may be distinguished by a typical walk "pattern" only for a sufficiently large number of units....

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>44) - chaos.phys.msu.ru/ )

• http://chaos.phys.msu.ru/loskutov/My_hobbies/Rome_history/pericles.htm
• http://chaos.phys.msu.ru/loskutov/PDF/JETP10_05_Post_Los.pdf
• http://chaos.phys.msu.ru/loskutov/PDF/Stabilization_by_point_exitations.pdf

... Î UNÈX . ... HelpOnDictionaries . Íåèçìåíÿåìàÿ ñòðàíèöà . ... Dictionaries . Wiki Dicts . ... Other ways to define dicts / access dict definitions A dictionary is a simple data structure that maps a dictionary name to a set of key/value pairs. ... The dictionary name usually is something like GermanDict (some word ending with Dict ). This default pattern can be changed (e.g. for non-english languages etc.), see page_dict_regex on HelpOnConfiguration . ... See dicts on HelpOnConfiguration . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>164) - uneex.mithril.cs.msu.su/ )

• HelpOnGroups - UNÈX
• LecturesCMC/LinuxShell2008/06/01LinksAcl - UNÈX
• HelpMiscellaneous - UNÈX

... The Laboratory of Programming Technologies was established in 2001. The Laboratory's team consists of collaborators and graduate students of Computer System Automation Department that work under supervision of Professor Igor Mashechkin. ... series of works for research and development of multi-functional cross-programming system. ... Presently the main scientific direction of the Laboratory is research and development of algorithms and methods for creating data mining software. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>117) - en.cs.msu.ru/ )

• Laboratory of Programming Technologies | CMC MSU

... Thus, the development of a method of synthesis of signals of finite duration, optimal in the sense of maximum concentration of energy in specified frequency ranges, is the actual problem. ... Erik Larsen, Ronald M. Aarts, "Audio Bandwidth Extension: Application of Psychoacoustics, Signal Processing and Loudspeaker Design", John Wiley & Sons, ISBN: 0-470-85864-8, September 2004. ... Time-frequency decomposition, 2. ... Shaping of the energy spectrum envelope of high-frequency content, 4. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>272) - imaging.cmc.msu.ru/ )

• http://imaging.cs.msu.ru/pub/2015.ACIVS.Umnov_Krylov_Nasonov.SparseDeringing.en.pdf
• http://imaging.cs.msu.ru/pub/2002.graphicon.Krylov_Korchagin_Lukin.Hermite.en.pdf
• View publication | Laboratory of Mathematical Methods of Image Processing

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>22) - mouse.genebee.msu.ru/ )

• Nhunt

Beilstein Journal of Organic Chemistry Preliminary Communication Open Access Efficient synthesis of 5-substituted 2-aryl-6cyanoindolizines via nucleophilic substitution reactions Eugene V Babaev*, Natalya I Vasilevich and Anna S Ivushkina Address: Department of Chemistry , Moscow State University, 119992, Moscow, Russia Email: Eugene V Babaev* - babaev@org.chem.msu.su; Natalya I Vasilevich - nikto25 ... Nucleophilic substitution also occured with sulfur nucleophiles. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>94) - www.chem.msu.ru/ )

• http://www.chem.msu.ru/eng/misc/babaev/papers/066e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/073e.pdf
• http://www.chem.msu.ru/eng/misc/babaev/papers/042e.pdf

... Ïîëîæåíèå îá îëèìïèàäå . ... Îòáîðî÷íûé ýòàï . ... îò Îðãêîìèòåò îëèìïèàäû øêîëüíèêîâ "Ëîìîíîñîâ" - ×åòâåðã, 25 Ôåâðàëü 2016, 12:10 . ... îò Îðãêîìèòåò îëèìïèàäû øêîëüíèêîâ "Ëîìîíîñîâ" - Ñðåäà, 3 Ôåâðàëü 2016, 18:52 . ... îò Îðãêîìèòåò îëèìïèàäû øêîëüíèêîâ "Ëîìîíîñîâ" - Ïîíåäåëüíèê, 1 Ôåâðàëü 2016, 17:12 . ... Îðãêîìèòåò îëèìïèàäû øêîëüíèêîâ ?Ëîìîíîñîâ? ïðèãëàøàåò âàñ ê ñîòðóäíè÷åñòâó ñ öåëüþ îðãàíèçàöèè è ïðîâåäåíèÿ çàêëþ÷èòåëüíîãî ýòàïà Îëèìïèàäû íà âàøåé áàçå ïî ðàçëè÷íûì ïðîôèëÿì. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>3) - olymp.msu.ru/ )

... Âûïóñêíèêè . Âûïóñêíèêè ÂÌèÊ . ... Æåíñêèé êëóá . Àêòèâíîå äîëãîëåòèå . ... Èçäàòåëüñòâî ÌÃÓ . ... Íîâîñòè äëÿ âûïóñêíèêîâ . ... Âûïóñêíèêè ÌÃÓ . ... Äàéâ-Êëóá ÌÃÓ . ... Àâñòðàëèéñêèå è áðèòàíñêèå áèîëîãè â õîäå ýêñïåðèìåíòà ïðèøëè ê âûâîäó, ÷òî ñêîðîñòü ñíèæåíèÿ èíòåëëåêòóàëüíûõ ñïîñîáíîñòåé ëþäåé â ïîæèëîì âîçðàñòå íà 24% îáóñëîâëåíà ìíîæåñòâîì ãåíåòè÷åñêèõ ôàêòîðîâ, êîòîðûå ïðîÿâëÿþòñÿ â âèäå íåáîëüøèõ ðàçëè÷èé â óñòðîéñòâå ãåíîìà, ãîâîðèòñÿ â ñòàòüå, îïóáëèêîâàííîé â æóðíàëå Nature . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>177) - www.moscowuniversityclub.ru/ )

• Êëóá âûïóñêíèêîâ ÌÃÓ: Êîíôåðåíöèÿ "Âûïóñêíèêè ÂÌèÊ"
• Êëóá âûïóñêíèêîâ ÌÃÓ: Êîíôåðåíöèÿ "Ìåñòî äëÿ çíàêîìñòâà"
• Êëóá âûïóñêíèêîâ ÌÃÓ: Êîíôåðåíöèÿ "Âûïóñêíèêè ÌÃÓ â ÑØÀ"

... ATOMS, MOLECULES, OPTICS On the Passive Probing of Fiber Optic Quantum Communication Channels A. V. Korol'kova, K. G. Katamadzeb, S. P. Kulikb, and S. N. Molotkova,c,d Academy of Cryptography of the Russian Federation ... based on InGaAs:P are the most sensitive and only detectors operating in the telecommunication wavelength range 1.30­1.55 µm in the fiber optic quantum cryptography systems that can operate in the single photon ... Both active and passive attacks are possible. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>61) - qi.phys.msu.ru/ )

• http://qi.phys.msu.ru/papers/2011-jetpl(e)-94-262.pdf
• http://qi.phys.msu.su/papers/2006-lasphys-16-1264.pdf
• http://qi.phys.msu.ru/kulik/Papers/LasPhys5_02BurlakovLO.pdf

Dear Colleagues, It is with pride and pleasure that I inform you that our colleague Jamie Galbraith has been elected to the Accademia Nazionale dei Lincei, also known as the Lincean Academy, the oldest honorific scientific academy in the world. Founded in 1603, the academy counts Galileo Galilei among its original members and has remained an elite organization, currently housing only 540 members, with only 180 of those from outside of Italy. ... From Galileo to Galbraith! ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>8) - www.mse-msu.ru/ )

... Post Office Box 786 . ... Post Office Box 197 . ... Post Office Box 161 . ... Originally published in Russian as Sistemologiya i yazikoviye aspekti kibernetiki . ... Melnikov. G. P. [Sistemologiya i yazikovye aspekty kibernetiki. ... Systemology and linguistic aspects of cybernetics/G. P. Melnikov: . ... Studies in cybernetics; v. 16) . Translation of: Sistemologiya i vazkovye aspektv kihernetiki. ... Cybernetics. ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>53) - old.philol.msu.ru/ )

• MSU-LGCLL:: Krylov J.K. - On the Nature of Koehler's Effect
• MSU-LGCLL:: Krylov J.K.- Three Laws of Fiction Prosaic Texts Organization

... What is the author's opinion on the problem? ... Organize the following parameters into 3 groups: content, organization, presentation (performance) · Body-language and eye contact · Fluency · Proper intonation and pronunciation · Relevant information and examples provided · Conclusion · Key concepts explained\defined · A range of complex grammatical structures and academic vocabulary · Key points emphasized · Introduction · Various linking devices, the transition from one point to the ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>14) - www.eng.math.msu.su/ )

... 2013 . ... Journals . ... ISSN 1468-4845 (online) . ... Regular and Chaotic Dynamics is an international peer-reviewed journal publishing original research papers in dynamical systems theory and its applications. ... The journal seeks to promote the development of multilateral relations theory and applications, interaction of different disciplines, the use of modern mathematical and computer methods in the study of real dynamic systems. ... Institute of Computer Science Izhevsk, 2005 - 2016 . ...

Åùå â ðàçäåëå: (Ïîêàçàòü âñå ðåçóëüòàòû (>82) - ics.org.ru/ )