... Chilingarian, I., Melchior, A.-L., Zolotukhin, I. 2010: Analytical approximations of K -corrections in optical and near-infrared bands , MNRAS, v. 405, p. 1409 (also arXiv:1002.2360) . ... Calculator . ... calculate spectral energy distributions , K-corrections calculator , UKIDSS YJHK , K-corrections of galaxies , spectral based k-corrections , SDSS filter set K-corrections , K correction code IDL , kcorrect IDL C , . ...

Еще в разделе: (Показать все результаты (>8) - kcor.sai.msu.ru/ )

• K-corrections calculator (version 2010)

... On August 4, near cape Kartesh , in a sand bay (square approximately 600 sq. m) about 18.00 the mass thrown out of jelly-fishes ( Aurelia aurita ) was noticed. The wind this day was northern, 3-4 balls, cloud cover 75 %, maximum of an inflow at 20.40, 0,8 m. This phenomenon was described. For each jelly-fish we marked: . ... That day 130 jelly-fishes were investigated . ... The same phenomenon was marked this day and in the other bays, but in the other size. ...

Еще в разделе: (Показать все результаты (>121) - herba.msu.ru/ )

• Complete flora of islands and lakes as a statistical hypothesis

Dynamics of light-induced quantum transitions in polyatomic molecules B. A. Grishanin and V. N. Zadkov International Laser Center at M. V. Lomonosov Moscow State University, 119899 Moscow, Russia V. D. Vachev and J. Frederick Chemical Department of Nevada State University, Reno, Nevada, 89557 USA Submitted 21 November 1995 ґ Zh. ... Whereas the motion on a given electronic level may be considered as a purely classical process, the dynamics of electronic transitions is purely quantum. ... J. Chem. ...

Еще в разделе: (Показать все результаты (>69) - qilab.phys.msu.ru/ )

• http://qilab.phys.msu.ru/papers/SPIE-2802-6-14(1996).pdf
• http://qilab.phys.msu.ru/papers/Laser-Physics-20(1)107-118(2010).pdf
• http://qilab.phys.msu.ru/papers/Quantum%20Electronics%2035(1)%2080.pdf

... Is it correct ? ... V-gauge ansatz LS-equation V-SFA (first Born, Bauer) V-gauge ansatz The corresponding L-gauge ansatz gives the same V-SFA. Formula (10) generates the gauge-invariant family. L-gauge ansatz LS-equation L-SFA (first Born, Keldysh) L-gauge ansatz The ansatz (11) generates now another gaugeinvariant family. ... Conclusions Correct gauge transformation of the chosen ansatz gives the gauge invariant Born series, which can be called as the gauge invariant family. ...

Еще в разделе: (Показать все результаты (>11) - lmmqsp.sinp.msu.ru/ )

• Laboratory of Mathematical Models of Quantum Scattering Processes / MSU

... This technology presumes that blood sampling is performed by patient himself, the sample is spotted on a dry, as a rule, porous surface (filter paper, cellulose acetate membrane, etc.), and the posterior transportation to a laboratory, for example, by post in a standard or a special envelope. ... Under the dried blood spot technology using, the problem of the sample spotted volume determination remains one of the main practical questions. ... The problem is to find a function f (y1 , y2 , . ...

Еще в разделе: (Показать все результаты (>88) - higeom.math.msu.su/ )

Welcome , Registration , and other StartingPoints ; TWiki history & Wiki style; All the docs.. ... The following Perl modules are used by TWiki: . ... Algorithm::Diff (included) . CGI::Carp . ... File::Copy . ... File::Find . ... Algorithm::Diff (included in TWiki distribution) . ... Error (included in TWiki distribution) . ... The following Perl modules may be used by TWiki: . ... Used for session support . CGI::Session . ... Used for I18N support with perl 5.6 . ... Used for I18N support . ...

Еще в разделе: (Показать все результаты (>17813) - dualopt1.cmm.msu.ru/ )

• TWikiStoreQueryAlgorithmsBruteForceDotPm - TWiki - TWiki
• TWikiStoreRcsWrapDotPm - TWiki - TWiki - (printable)
• %TOPICTITLE% ( vs. 1) - TWiki

Microsymposium 38, MS067, 2003 (A4 format) SURVEY OF MARS CRATER TOPOGRAPHY FROM MOLA DATA. Michael G. G., European Space Agency, Research and Scientific Support Department, ESA/ESTEC, Noordwijk, The Netherlands, greg.michael@esa.int An algorithm for autonomous identification of crater centres from topography data has been improved in accuracy since [1,2] by taking account of the slope direction on the interior of the crater rim. ... References: [1] Michael G. G. (2002) Vernadsky-Brown 36, abs. ...

Еще в разделе: (Показать все результаты (>47) - selena.sai.msu.ru/ )

• http://selena.sai.msu.ru/Shev/Publications/ms38/ms082.pdf
• http://selena.sai.msu.ru/Bus/Publications/m44_14_busarev_etal.pdf
• http://selena.sai.msu.ru/Bus/Publications/UFN2007(Bus_etal)(engl).PDF

... Библиотека электронных публикаций . ... Title: Memory effects in the relaxation of Ising models . Authors: J. Javier Brey, A. Prados . Comments: 7 pages, 2 figures . ... Comments: 10 pages, 2 figures, To be published in Physica A . ... Comments: Accepted for publication in ApJ. (17 pages, 18 figures) . ... Comments: 15 pages including two postscript figures . ... astro-ph/0105073 Title: Time Dilation and Quasar Variability Authors: M.R.S. Hawkins Comments: 6 pages including 3 figures. ...

Еще в разделе: (Показать все результаты (>372) - chronos.msu.ru/ )

• Лаборатория-кафедра развития реляционных методов изучения времени
• S.M.KOROTAEV. EXPERIMENTAL VERIFICATION OF TRANSACTION OF THE DISSIPATIVE
• REVIEWS OF MODERN PHYSICS

Faculty of Physics, Lomonosov Moscow State University Advanced Quantum Field Theory: Modern Applications in HEP, Astro & Cond-Mat Instructor: assist. prof., Dr. Oleg Kharlanov Term 2 Examination Syllabus (Fall 2014) 1. ... Self-consistent field approximation: the Hartree­Fock and Hartree­Fock­Roothaan equations; a qualitative analysis of the approximations used. ... Fundamentals of the Density functional theory: the energy functional, the Hohenberg­Kohn theorems, the universal functional F[n(x)] . ...

Еще в разделе: (Показать все результаты (>7) - theorphys.phys.msu.ru/ )

The QFont class is an abstract specification of an ideal font. ... First an available font family is found. ... character set . ... point size . ... If, for example, a font with the correct character set is found, but with all other attributes in the list unmatched, it will be chosen before a font with the wrong character set but with all other attributes correct. ... Using the correct font family has higher priority than using the correct character set. ...

Еще в разделе: (Показать все результаты (>213) - rtm-cs.sinp.msu.ru/ )

• Linux AI & Alife HOWTO
• State of development
• Qt Toolkit - QStoredDrag Class

... Gates, Bill, "Algorithms and Blues: If You Can Fathom Programming Text, Send Bill a Resume", The Toronto Sun, April 26, 1995, Section Connect, p. 46. Knuth, Donald E., The Art of Computer Programming, Volume 1: Fundamental Algorithms, Second Edition (Reading, MA: Addison-Wesley). ... Woehr, Jack, "An Interview with Donald Knuth: One of the World's Top computer Scientists", Dr. Dobb's Journal, Vol. 21; No. 4; p. 16, April 1996. ...

Еще в разделе: (Показать все результаты (>89) - www.nature.web.ru/ )

• Специалисты в IBM построили квантовый компьютер
• "Введение в криптографию" под редакцией В.В.Ященко

... Кафедра системного анализа ВМК МГУ . ... О кафедре . ... на кафедру . ... ВМК . МГУ . ... СМУ ВМК . ... Alexandr Borisovich Kurzhanski) . In Russian . ... Kurzhanski was Elected Associate Member of USSR Academy of Sciences (now changed to Russian Academy of Sciences) in 1981 and Full Member in 1990. He is the Chairman of the Russian National Committee on Automatic Control (the IFAC NMO). ... Chairman of Russian National Committee of Automatic Control. ... 4 (8). pp. 100-118. (in russian). ...

Еще в разделе: (Показать все результаты (>2) - sa.cs.msu.ru/ )

Experimental Study of the Acoustic Field Generated by a 50 MeV Electron Beam in Water V. B. Bychkov1, V. S. Demidov2, E. V. Demidova2, A. N. Ermakov3, O. D. Ershova3, B. S. Ishkhanov3, V. P. Maslyany1, A. Yu. ... At a two-dimensional diagram (distance-time) two signal tracks were observed from two sound sources: a cylindrical acoustic antenna generated by the electron beam, and an area of the beam entrance cap which divides the water medium from the air. ... Fig. ... Arrows mark the beam spill time. ...

Еще в разделе: (Показать все результаты (>10) - antares.sinp.msu.ru/ )

Computation of multiple eigenvalues and generalized eigenvectors for matrices dependent on parameters arXiv:math-ph/0502010 v1 2 Feb 2005 Alexei A. Mailybaev Abstract The pap er develops Newton's method of finding multiple eigenvalues with one Jordan block and corresp onding generalized eigenvectors for matrices dep endent on parameters. It computes the nearest value of a parameter vector with a matrix having a multiple eigenvalue of given multiplicity. ... m be eigenvalues of the matrix A0 . ...

Еще в разделе: (Показать все результаты (>28) - mailybaev.imec.msu.ru/ )

• http://mailybaev.imec.msu.ru/papers/SeyranianMailybaev2001.pdf

Modules | Directives | ... Apache HTTP Server Version 2.0 . ... Content cache keyed to URIs . ... Experimental . ... It acts as a support module for mod_cache and provides a memory based storage manager. mod_mem_cache can be configured to operate in two modes: caching open file descriptors or caching objects in heap storage. mod_mem_cache is most useful when used to cache locally generated content or to cache backend server content for mod_proxy configured for ProxyPass (aka reverse proxy ). ...

Еще в разделе: (Показать все результаты (>452) - itpm.msu.su/ )

• How Does Usenet Handle News?
• Language information and text direction
• htpasswd - Manage user files for basic authentication - Apache HTTP Server

Contents Curricula, and Programs. Mathematical Analysis. (The Program of Mathematical Physics Department).............................................. Algebra and Analytical Geometry.(The program of (General "Mathematics" Department)................................ Computer and Programming. (The program of Algorithmic Languages Department).................................... The practical work on Computers.( Department of Algorithmic. Languages)............................................... Discrete

Еще в разделе: (Показать все результаты (>4) - mph.cmc.msu.ru/ )

... Results Comparison with FASTA archaean genomes. ... But each of these programs has some signicant Table 1: Numb er of found alignments with E-value less than given Program FASTA Nhunt Run time 5.5 1.4 Example alignment : Query: ctgtttaccaggtcaggtccggaaggaagcagccaaggcagatgacgcgt aaaaaaaa||||aa|||||a|a|aaa|||a||aa|| |||||||aa||a|||aa||a| Sbjct: ctgtgaaccagcttatcgccgcaatcaaacagccaaatcatatgcagcat Identity = 33/50 (66%) Strand: Plus/Minus Alignment features without scoring ...

Еще в разделе: (Показать все результаты (>8) - mouse.genebee.msu.ru/ )

• Nhunt: program for nucleic acid sequence similarity search
• ConClus
• Nhunt

NAME htpasswd - Create and update user authentication files SYNOPSIS htpasswd [ - c ] [ - m | ... p ] passwdfile username password htpasswd - n [ - m | ... p ] username password DESCRIPTION htpasswd is used to create and update the flat-files used to store usernames and password for basic authentication of HTTP users. ... Resources available from the httpd Apache web server can be restricted to just the users listed in the files created by htpasswd. ... The user is prompted for the password. ...

Еще в разделе: (Показать все результаты (>33) - neptun.sai.msu.ru/ )

• Apache module mod_auth_digest
• Apache Content Negotiation
• Descriptors and Apache

Wednesday, August 22nd, 2012 . GTOPO30 is a global digital elevation model (DEM) with a horizontal grid spacing of 30 arc seconds (approximately 1 kilometer)? (http://eros NULL .usgs NULL .gov/#/Find_Data/Products_and_Data_Available/gtopo30_info) . ... You are currently browsing the Лаборатория лазерной интерферометрии blog archives for August, 2012. ... Наши публикации . ... Публикации за 2010 . Публикации за 2011 . ... Лаборатория лазерной интерферометрии is proudly powered by WordPress . ...

Еще в разделе: (Показать все результаты (>7) - geo.sai.msu.ru/ )

• GTOPO30 Лаборатория лазерной интерферометрии
• etopo Лаборатория лазерной интерферометрии
• gmt Лаборатория лазерной интерферометрии

... 1998) · - , · : , , , · , TVD · · - X 24 ­ 30 2011, 5 1.4, M0 6, Re 2.25 10o , Tw , Pr 0.7, 15 x* 0.28, 1 III III IV IV X 24 ­ 30 2011, IV 900 2 10 Re * s0 5 10 3 3 2 10 450 103 2 8 102 225 5 104 2 45 10 4 X 24 ­ 30 2011, III 450 103 Re * s0 2 10 2 4.08 102 315 7 104 0.125 180 4 10 4 2 45 10 4 X 24 ­ 30 2011, Qs sVsn 1 Vs2 cs Ts Tw Q0 2 3%, s0 / 0 103 , 1 1%, s0 / 0 103 , 1 X 24 ­ 30 2011, X 24 ­ 30 2011, Pr 1, K 1 1.4, M 2 x X 24 ­ 30 2011, Pr 1, K 1 1.4, 2 X 24 ­ 30 2011, , : ; , . ...