... Если она пуста (это значит, что в данном случае Вы пользуетесь не стандартным полевым дневником, а обычной тетрадью или блокнотом), укажите, что это "Полевой дневник ?...", кому он принадлежит, к какой организации относится тот, к кому он принадлежит (вопрос на "тройку": к какой?), когда дневник начат и когда закончен, с какой точки наблюдения (обычно т.н. 1) по какую, даты, когда он начат и закончен, и куда нужно вернуть дневник, если он случайно потеряется. ... Например: "Рис. ...

Еще в разделе: (Показать все результаты (>18) - dynamo.geol.msu.ru/ )

• Posters by Zakharov V.S.

. PQ is a program for phylogeny reconstruction. Please paste a multiple sequence alignment (100 sequences maximum) in fasta format ( example ). Search strategy . Single growing Multiple growing NNI search . Matrix . Diagonal BLOSUM62 Special . Algorithm: Sergei Spirin, Mikhail Krivozubov, Dmitry Penzar . Programming: Dmitry Penzar . Funding: Russian Foundation for Basic Research, grant no. 13-07-00969 . Moscow State University, 2015 2016

Еще в разделе: (Показать все результаты (>5) - mouse.belozersky.msu.ru/ )

.

Еще в разделе: (Показать все результаты (>4) - www.msu.dubna.ru/ )

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>29) - nanofluidics.phys.msu.ru/ )

• Contacts

... The "diagrams of minimum expected tsunami arrival time" are shown for 25 coastal sites; the TWS dead zones for each of these sites are distinguished by more frequent isolines (every 1 min). ... I ( is the site name). ... We presented isolines of minimum expected tsunami time for all these sites. ... However, there are also sites, In every such case the minimum expected tsunami time tmin has to be to the minimum tsunami propagation time at the distance R in the direction to the respective settlement....

Еще в разделе: (Показать все результаты (>25) - seac47-2.phys.msu.ru/ )

• LOCAL TSUNAMI WARNING AND MITIGATION -- Official information

... Выпускники . Выпускники ВМиК . ... Женский клуб . ... Издательство МГУ . ... Выпускники МГУ . ... Дайв-Клуб МГУ . ... Senior IFP Fall 2005 . The Center on Philanthropy and Civil Society's Senior International Fellows Program provides an opportunity for the professional development of Third-Sector practitioners from outside the United States who are decision makers in their professions. The program is designed to help build Third-Sector capacity in the Fellows' home countries. ...

Еще в разделе: (Показать все результаты (>186) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Конференция "Выпускники ВМиК"
• Клуб выпускников МГУ: Meeting in Toronto, June 27, 2009
• Клуб выпускников МГУ: Конференция "Выпускники МГУ в США"

... Length=2222430 Score = 55.4 bits (60), Expect = 6e-08 Identities = 53/68 (78%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 141 TTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTC 200 || Sbjct 1090874 TTACTGGGCTTAAAGCGCCCGTAGCCGGCCCGGCAAGTCGCTCCTGAAATCCCCGGGCTC 1090933 Query 201 AACCTGGG 208 || ... Sbjct 2071246 AGCCGCGGTAATACGG 2071261 Score = 28.3 bits (30), Expect = 8.9 Identities = 15/15 (100%), Gaps = 0/15 (0%) Strand=Plus/Plus Query 222 ACTGGCAAGCTTGAG 236 || ...

Еще в разделе: (Показать все результаты (>9) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/blast_default.out
• Nhunt: program for nucleic acid sequence similarity search

... If you have already registered, please fill in you login and password in the form below main menu (leftmost column). ... If something goes wrong (for example, you've been registered by site andministrator and don't have password at all or you just forgot it), please contact site administration by E-mail dubna2007@biophys.msu.ru . ... If you are warned that you've already registered please contact site administration by E-mail dubna2007@biophys.msu.ru to get access to your Personal Office . ...

Еще в разделе: (Показать все результаты (>46) - www.msm.biophys.msu.ru/ )

. If you see this page, the nginx web server is successfully installed and working. Further configuration is required. For online documentation and support please refer to nginx.org . Commercial support is available at nginx.com . Thank you for using nginx.

90. http://sn.sai.msu.ru/~sil/preprints/my_an.pdf

91. http://phys.msu.su/rus/about/structure/admin/EPFL.doc

92. http://swx.sinp.msu.ru/models/sw_forecast.php

93. http://www.msu.ru/work/2008/Anketa.doc

94. K-corrections calculator

95. Registration International Conference Differential Equations and Topology

96. MsuNews.Ru

97. Molecular aspects of solid state and interfacial electrochemistry

98. admin | sparallel.ru - Part 223

99. A.P.Levich. What we expect from studying time

100. Lomonosov 2016 / МГУ имени М.В.Ломоносова