... Organizing committee . ... Selected papers of MCCMB'13 participants will be published in the Journal of Bioinformatics and Computational Biology . If you plan to submit your paper to the MCCMB issue of JBCB, please send to Prof. M.Gelfand (gelfand 'at' iitp.ru) a short message with a preliminary list of authors and a tentative title of your paper. ... September 30th, 2013 paper submission. ... Select a box stating that the paper goes to the MCCMB issue. ... January 30th, 2014 final decision. ...

Еще в разделе: (Показать все результаты (>192) - mccmb.belozersky.msu.ru/ )

Клуб выпускников МГУ (Московский Государственный Университет) . ... Resvinatrol Complete - на данный момент, первая добавка на рынке, которая использует благоприятное воздействие антиоксиданта ресвератрола, обнаруженного в красном вине, на сердце и замедление процесса старения. Ресвератрол, всего один из сильных антиоксидантов, входящих в состав добавки Resvinatrol Complete. ... Комбинация антиоксидантов Resvinatrol Complete не имеет себе равных на современном рынке антиоксидантной продукции'. ...

Еще в разделе: (Показать все результаты (>176) - www.moscowuniversityclub.ru/ )

• Клуб выпускников МГУ: Кайя Кальпа: продление жизни и бессмертие
• Клуб выпускников МГУ: CRISIS IN THEORETICAL PHYSICS: THE PROBLEM OF SCIENTIFIC
• Клуб выпускников МГУ: Обсуждение материала "Таблетки замедляющие процесс

To see a Russian version of this page, click here . ... Bochkarev Nikolai Gennadievich . astrophysics researcher: . born: Moscow, May 19, 1947; . ... Jr. researcher Sternberg Astronomical Inst., ... Soviet (Russian) Working Group on Interstellar Matter, Moscow , 1979-; . ... Madison, 1991. ... ALocal Interstellar Matter, 1990, . Basic Physics of the Interstellar Matter, 1992; co-author: . ... Physics of Interstellar Matter, 1979; . ... All-Union Astronom. Geodesical Soc., ... Astronom. ...

Еще в разделе: (Показать все результаты (>15) - uranus.sai.msu.ru/ )

... Correlative immunostaining with anti-tubulin antibodies and electron microscopy established that apparent free microtubules observed in vivo were not growing ends of long stable microtubules. ... A) Plus and minus ends of free MTs; (B) ends of long MTs. ... Minus ends of free MTs in PtK1 cells are stable The production of free minus ends of MTs in PtK1 cells has now been observed by three pathways: self-assembly in the cytoplasm, release from the centrosome (Keating et al., 1997) and breakage of MTs...

Еще в разделе: (Показать все результаты (>39) - cellmotility.genebee.msu.ru/ )

• picture2
• picture3
• about_us

Poligraphic complex (printing plant) - humanitarian aid from RRU to South Ossetia A.A. Tibilov State University The printing plant is intended to make a wide range of materials - textbooks, manuals, presentations, reports, informational and commercial printed matters. ... wide color range, surpassing that of offset printing; . ... simple operation and high reliability. [pic] Besides the printer, there is a digital color copier Duplo DPS850 (Japan) size A3, in the printing complex. ...

Еще в разделе: (Показать все результаты (>23) - www.rsr-online.ru/ )

• http://www.rsr-online.ru/doc/norm/273.doc

.

Еще в разделе: (Показать все результаты (>5) - www.chemport.ru/ )

... MG1655 chromosome, complete genome Length=300 Score E Sequences producing significant alignments: (Bits) Value embl|AE009441|AE009441 Pyrobaculum aerophilum str. ... Length=2222430 Score = 98.4 bits (402), Expect = 5e-21 Identities = 150/234 (65%), Gaps = 1/234 (0%) Strand=Plus/Plus Query 68 CCCGCAGAAGAAGCACCGGCTAACTCCG-TGCCAGCAGCCGCGGTAATACGGAGGGTGCA 126 || ... Sbjct 97796 GTTCTCCCGCCGAAGTGCTTGAGATACTCGCAACCGTGAATCTCAAAAAGAGG 97848 > embl|AE006641|AE006641 Sulfolobus solfataricus P2, complete...

Еще в разделе: (Показать все результаты (>15) - mouse.genebee.msu.ru/ )

• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/blast_default.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex2/megablast.out
• http://mouse.genebee.msu.ru/~bennigsen/nhunt_files/ex3/fasta.out

05 Nov 2003 The Sun has continued its recent high levels of activity. At 1950 UT, 4 November 2003, a class X28 solar flare was released by the Sun. ... LASCO C2 Images of X28 Flare at 1950UT 04/11/2003 . ... SOHO (Solar and Heliospheric Observatory) is located between the Sun and the Earth and will, therefore, detect activity before it reaches the Earth. ... All this ongoing solar activity means that the Earth is destined to be bathed in more radiation - generating further auroral displays. ...

Еще в разделе: (Показать все результаты (>87) - www.kosmofizika.ru/ )

• Frequently Seen Space/Astronomy Acronyms

... Seminars . ... Group 417 [ PDF ] Students are expected to attend lectures and seminars which is the standard forum for class communication. ... Some of the homework problems might appear on the tests and the exam. ... Your class grade total percentage is given by 40% seminar and homework, 25% first test and 35% second test. ... Students with the class grade 5 and 4 may get a final course grade without a final exam, but only upon the recommendation of seminar assistants. ... Test 1 [ PDF ] . ...

Еще в разделе: (Показать все результаты (>30) - nanofluidics.phys.msu.ru/ )

. Источники: . 226 Ra . Неизвестные . 1 . 2 . 3 . 4 . Масшаб по Y: . 32 64 128 256 512 1024 2048 4096 8192 16384 32768 65536 . Время измерения . 1 2 3 4 5 6 7 8 9 10 50 100 сек . alt=" Your browser understands the APPLET> tag but isn't running the applet, for some reason." Your browser is completely ignoring the APPLET> tag!

Еще в разделе: (Показать все результаты (>135) - nuclphys.sinp.msu.ru/ )

• Определение расстояния между источником и детектором
• Определение периода полураспада и сечения взаимодействия тепловых нейтронов
• "Классическая" интерпретация символов измерения Швингера

... Executing config_lcgenv Executing config_java Executing config_ glite _tar_ui gLite Security Utilities configuration successfully completed xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Configuring the gLite R-GMA Client xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Checking configuration values [ OK ] Verifying the / gLite / glite / etc ... Configuring BDII based Service Discovery [ OK ] Configuring R-GMA based Service Discovery .. ...

Еще в разделе: (Показать все результаты (>6) - lhe.sinp.msu.ru/ )

Variety of Long-Eared Owls (Asio otus L.) Diet as Index of Habitats Usefulness. ... Owls draw to themselves attention, due to a number of such features, as a wide circulation practically in all natural zones, an originality of ecology, behavior and morpho-physiology; prospect synantropisation some species on a background of disturbing decrease in number of others, difficultly observable and, still, poorly studied. ... Adult owl brings young sparrow from birddealer to his fledgling. ...

Еще в разделе: (Показать все результаты (>52) - vertebrata.bio.msu.ru/ )

• http://vertebrata.bio.msu.ru/Curlew_Sandpipers_Calidris_ferruginea_on_their_breeding_grounds.pdf
• http://vertebrata.bio.msu.ru/mamm.70.1-2.106.pdf
• http://vertebrata.bio.msu.ru/Doklady_Binlngical_Sciences.pdf